1. What do you like and not like about the Simple Bills concept? 2. Would you recommend...

Question:

1. What do you like and not like about the Simple Bills concept?

2. Would you recommend raising funds from outside investors and growing faster or continuing to boot strap the operations to conserve ownership? Why?

3. What strategy would you suggest for growing the business, assuming new investors are brought in?

4. If you choose to raise funds, whom might you seek as investors?

Fantastic news! We've Found the answer you've been seeking!

Step by Step Answer:

Related Book For book-img-for-question

Small Business Management Launching & Growing Entrepreneurial Ventures

ISBN: 978-1133947752

17th edition

Authors: Justin Longenecker, William Petty, Leslie Palich, Frank Hoy

See More Books

Question Posted: Jan 14, 2015 09:28 AM

See More Questions

What do you like and dislike about the Crocs' organizational chart illustrated in the chapter, in terms of guidelines and dos and don'ts presented in the chapter?
Which of the following can possibly be part of the informal information search process for organizational buyers? a. site visits to evaluate a potential vendor b. laboratory test of a new product or...
1 What do you think is the biggest adjustment forcompanies changing from traditional costing to activity basedcosting 2 The difference between traditional costing and activitybased costing is that...
In 2020/21 Ella had taxable income (after deducting the personal allowance) of 52,000, all of which represented savings income. She paid 1,600 as a Gift Aid donation to the NSPCC (a registered...
Consulting Table 24.3, write the amino-acid sequence resulting from left-to-right translation of the messenger RNA sequence GGAUCCCGCUUUGGGCUGAAAUAG
The trial balance of American Dry Cleaners on June 30 is given here. The July transactions were as follows. July 8 Received $10,189 in cash on June 30 accounts receivable. 9 Paid employee salaries...
Consider the multiple linear regression model $\mathbf{y}=\mathbf{X} \boldsymbol{\beta}+\boldsymbol{\varepsilon}$. Show that the least-squares estimator can be written as...
According to the value Line Investment Survey, the growth rate in dividends for Duke Energy for the previous 10 years has been 1.5 percent. If investors feel this growth rate will continue, what is...
Required 1. Required 2 Required 3 s below. Stone needs to accumulate sufficient funds to pay a $490,000 debt that comes duelon December 31, 2029. The company will accumulate the funds by making five...
Match the assumption, principle, or constraint description with the appropriate term by placing a, b, c, d, e, and f on the appropriate line. a. Cost principle of measurement _____ Benefits of the...
1. What information would you want to help make your decision? 2. What would keep you from joining the startup company? 3. How does the timing in our career affect your decision? 4. Why might you...
1. Is work-life balance for everyone? 2. Is work-life balance simply a preference, or is it a necessity? 3. As an entrepreneur, would there be areas in your life that you would place at a higher...
A pipeline of $300 \mathrm{~m}$ length supplies liquid chlorine from a regulated 20 barg source to a process through a horizontal, new commercial steel pipe of actual inside diameter of \(2...
What age restrictions apply to marriages in your state?
a. Prepare a checklist of questions you could use to help determine whether a child has been neglected, abandoned, etc. b. Draft a flowchart of the procedural steps that are necessary in your state...
An employer's contributions into a registered pension scheme during the year to 30 June 2021 are 600,000. Explain how tax relief will be given on the contributions of 1,860,000 which the employer...
Do you think that any of the following marriages could be annulled on the ground of duress? a. Rita married Dan after Dan threatened to kill Ritas second cousin if she did not marry him. The only...
Two members of the class will role-play in front of the rest of the class a negotiation session involving a husband and wife who want to enter a separation agreement. They have two children, ages two...
Two flasks, each with a volume of 1.00 L, contain O 2 gas with a pressure of 380 mm Hg. Flask A is at 25C, and flask B is at 0C. Which flask contains the greater number of O 2 molecules?
Solve each equation. x 3 - 6x 2 = -8x
The data file liquor contains observations on annual expenditure on liquor (LIQUOR) and annual income (INCOME) (both in thousands of dollars) for 40 randomly selected households for three consecutive...
What would be your first choice for an advertising medium if you owned a rental car agency? Why?
If you were opening an office furniture store, how would you select a social networking site to introduce yourself to prospective customers?
1. What re the advantages the Sugal will likely gain if he decides to bring inventory storage and bike delivery in-house? 2. What complications might arise if Sugl makes this change? What might he...
Why are Incoterms 2020 and Terms of Payment considered an important factor in executing global trade contracts? and also provide five various examples and risk related risk factors,
What is the purpose of using the Loan Manager in QuickBooks?
What is typically not available for entry by an employee in an HRIS employee self-service application?

1. What do you like and not like about the Simple Bills concept? 2. Would you recommend...

Question:

Step by Step Answer:

1 This is a winwin situation for everyone The utility companies win because they get paid in a timel...View the full answer

Small Business Management Launching & Growing Entrepreneurial Ventures

Students also viewed these Management Leadership questions