A homologous DNA region, which was 20,000 bp in length, was sequenced among four different species. The
Question:
Construct a phylogenetic tree that describes the evolutionary relationships among these four species using the UPGMA method. Your tree should include values that show the percentage of nucleotide substitutions.
Transcribed Image Text:
Species A Species B Species CSpecies D Species A Species B Species C Species D 465 423 723 443 719 443 719 465 744 744 423 723
Fantastic news! We've Found the answer you've been seeking!
Step by Step Answer:
Answer rating: 71% (7 reviews)
We begin by identifying the pair that is the most closely related In this case it is species B and D ...View the full answer
Answered By
JAPHETH KOGEI
Hi there. I'm here to assist you to score the highest marks on your assignments and homework. My areas of specialisation are:
Auditing, Financial Accounting, Macroeconomics, Monetary-economics, Business-administration, Advanced-accounting, Corporate Finance, Professional-accounting-ethics, Corporate governance, Financial-risk-analysis, Financial-budgeting, Corporate-social-responsibility, Statistics, Business management, logic, Critical thinking,
So, I look forward to helping you solve your academic problem.
I enjoy teaching and tutoring university and high school students. During my free time, I also read books on motivation, leadership, comedy, emotional intelligence, critical thinking, nature, human nature, innovation, persuasion, performance, negotiations, goals, power, time management, wealth, debates, sales, and finance. Additionally, I am a panellist on an FM radio program on Sunday mornings where we discuss current affairs.
I travel three times a year either to the USA, Europe and around Africa.
As a university student in the USA, I enjoyed interacting with people from different cultures and ethnic groups. Together with friends, we travelled widely in the USA and in Europe (UK, France, Denmark, Germany, Turkey, etc).
So, I look forward to tutoring you. I believe that it will be exciting to meet them.
3.00+
2+ Reviews
10+ Question Solved
Related Book For
Question Posted:
Students also viewed these Biology questions
-
Lets assume the linker DNA averages 54 bp in length. How many molecules of H2A would you expect to find in a DNA sample that is 46,000 bp in length?
-
The following are two DNA sequences from homologous genes: TTGCATAGGCATACCGTATGATATCGAAAACTAGAAAAATAGGGCGATAGCTAGTATGTTATCGAAAAGTAGCAAAATAGGGCGATAGCTACCCAGACTACCGGAT The two sequences, however, do...
-
A team of researchers has obtained a dinosaur bone (Tyrannosaurus rex) and has attempted to extract ancient DNA from it. Using primers to the 12S rRNA mitochondrial gene, they have used PCR and...
-
1. [20 points] A mattress manufacturer has three production facilities located in Pittsburg (PA), Houston (TX), and Los Angeles (CA). They supply their products to three distribution centers in...
-
The town of Whoville has 100 identical consumers and 50 identical car washes. Each consumer has an income of $24. The diagram and chart below show the indifference curves of a typical consumer and...
-
Distinguish between surface-level diversity and deep-level diversity. Why is it important to understand the difference between the two?
-
An irreversible machine is also called self-locking machine. True or False
-
Haughton Company uses a job costing system for its production costs and a predetermined factory overhead rate based on direct labor costs to apply factory overhead to all jobs. During the month of...
-
On January 1 , 2 0 2 3 Rent from Us Inc., an accrual basis , calendar year taxpayer, received $ 4 0 , 0 0 0 from a tenant as payment for four years worth of pre paid rent on the apartment they rent...
-
Use the below table to answer the following questions. Selling price = $28.00 Required: a. Determine the sales volume, fixed cost, and variable cost per unit at the break-even point. b. Determine the...
-
Discuss how the principle of parsimony can be used in a cladistics approach of constructing a phylogenetic tree.
-
As discussed in this chapter and Chapter 26, genes are sometimes transferred between different species via horizontal gene transfer. Discuss how horizontal gene transfer might give misleading results...
-
The following items may contain errors in grammar, capitalization, punctuation, abbreviation, number style, word division, and vocabulary. Rewrite each sentence, correcting all errors. If a sentence...
-
The refrigerator operates with a power of 250 watts, and is in it all the time. temperature of 0C. The ambient temperature is 37C. Walls refrigerators have a total area of 3 m and are made of...
-
A-1.0-C charge experiences a 15-N electric force in a certain electric field. Part A What force would a proton experience in the same field? Express your answer in newtons. F = Submit IVE 15 Previous...
-
9. The diameter of the base of a cylindrical chimney is 6', its height is 30', and its weight is 1200lbs. What should be the smallest tie down force that will prevent its toppling in an earthquake...
-
Question 18: Transformers work with alternating current, but not direct current. Why is this? Explain? Primary winding Np turns Primary current Primary voltage Vp Magnetic Flux, Transformer Core...
-
A jumpy squirrel is trying to cross the street. Its velocity v as a function of time t is given in the graph below where rightwards is the positive velocity direction. v (m/s) 5- 4 3 2- 1 2- 3- -4- 5...
-
Consider the hypothetical reaction between A 2 and AB pictured below. What is the balanced equation? If 2.50 moles of A 2 are reacted with excess AB, what amount (moles) of product will form? If the...
-
1. Use these cost, revenue, and probability estimates along with the decision tree to identify the best decision strategy for Trendy's Pies. 2. Suppose that Trendy is concerned about her probability...
-
Is it possible for spruce trees to grow directly on the rocks deposited by glaciers? Why or why not?
-
Why do you think that weeds can initially establish sites undergoing secondary succession, rather than the lichens that must initially colonize environments undergoing primary succession?
-
Distinguish between freshwater wetlands and estuaries and between flowing-water and standing-water ecosystems.
-
Question: d. ?During December, Ingrid Legal Services provided legal services, and the client prepaid $7,000. ?Ingrid Legal Services recorded this amount as Unearned Revenue. The job will take several...
-
Question: A company had the following purchases and sales during the month of November:\table[[Date,Activities,Units Acquired at Cost,Units Sold at Retail],[November 1,Beginning inventory,5 units @...
-
Question: Tania, Inc. issued a note payable with principal and interest due at the end of the term of the note. Details about the note payable are as follows:Issuance date: October 1, fear...
Study smarter with the SolutionInn App