A sprinter in a 400-m race accelerates uniformly for the first 130 m and then runs with
Question:
(a) His acceleration,
(b) His final velocity,
(c) His time for the race.
Fantastic news! We've Found the answer you've been seeking!
Step by Step Answer:
Answer rating: 100% (5 reviews)
a During the acceleration phase x x vot at Using xo 0 and vo 0 and solving fo...View the full answer
Answered By
Kainat Shabbir
i am an experienced qualified expert with a long record of success helping clients overcome specific difficulties in information technology, business and arts greatly increasing their confidence in these topics. i am providing professional services in following concerns research papers, term papers, dissertation writing, book reports, biography writing, proofreading, editing, article critique, book review, coursework, c++, java, bootstarp, database.
5.00+
184+ Reviews
255+ Question Solved
Related Book For
Vector Mechanics for Engineers Statics and Dynamics
ISBN: 978-0073212227
8th Edition
Authors: Ferdinand Beer, E. Russell Johnston, Jr., Elliot Eisenberg, William Clausen, David Mazurek, Phillip Cornwell
Question Posted:
Students also viewed these Mechanical Engineering questions
-
A sprinter accelerates from rest to 9.00 m / s in 1.38 s. What is her acceleration in (a) m / s2; (b) km / h2?
-
A sprinter of mass 65.0 kg starts his race by pushing horizontally backward on the starting blocks with a force of 200 N. (a) What force causes him to accelerate out of the blocks: (1) his push on...
-
A car accelerates from 14 m / s to 21 m / s in 6.0 s. What was its acceleration? How far did it travel in this time? Assume constant acceleration.
-
A. What is Alpha One's NOPAT? Why does NOPAT differ from the earnings after taxes? B. Estimate the effective before-tax cost of the long-term debt. c. Estimate the effective after-tax cost of the...
-
With the advent of managed care, U.S. hospitals have begun to operate like businesses. More than ever before, hospital administrators need to know and apply the theories and methods taught in...
-
Explain what the following assumptions and principle mean in accounting: a. Separate-entity assumption c. Continuity assumption b. Unit-of-measure assumption d. Cost principle
-
ABS Plumbing Ltd wants to prepare flexible budget cost estimates for the following items within a range of 33000 to 41000 chargeable hours. Required (a)Prepare a flexible overhead budget for 33000,...
-
The following are accounting items taken from Tyrone Shoelaces Companys records for 2016: a. Net income, $22,900 b. Payment for purchase of land, $4,000 c. Payment for retirement of bonds, $6,000 d....
-
Clark Company's current year income statement, comparative balance sheets, and additional information follow. For the year. (1) all sales are credit sales. (2) all credits to Accounts Receivable...
-
1 : In a certain fight crew, the positions of the pilot, and fight engineer are held by three persons, Ali, Bilal and Zain. Through not necessarily in that order. The co. Pilot who is an only child...
-
Steep safety ramps are built beside mountain highways to enable vehicles with defective brakes to stop safely. A truck enters a 750-ft ramp at a high speed v0 and travels 540 ft in 6 s at constant...
-
A group of students launches a model rocket in the vertical direction. Based on tracking data, they determine that the altitude of the rocket was 27.5 m at the end of the powered portion of the...
-
On January 1, Year 2, KimCom Boat Rentals purchased a boat that is to be used to produce rental income. The boat cost $120,000. It has an expected useful life of 10 years and a $20,000 salvage value...
-
a. What is the difference between liabilities and equity? b. What makes a liability a current liability? c. Provide some examples of current liabilities. d. What is the difference between long-term...
-
From a global economy perspective, what are the ethical issues that need to be considered to account for the possibility of conflicting issues and influences?
-
What traits do dominant people possess? Is there a best place for salespeople on the dominance continuum?
-
Bright Horizons Skilled Nursing Facility, an investor-owned company, constructed a new building to replace its outdated facility. The new building was completed on January 1, 2020, and Bright...
-
Although trust is an essential element of every sale, the meaning of trust changes with the type of sale. What are the three main types of sale, and how does the nature of trust change within the...
-
You want to walk down your icy driveway without sliding. If the incline of the driveway is \(15^{\circ}\) from the horizontal, what must the coefficient of static friction be between your shoes and...
-
Find the volume of the described solid S. A frustum of a right circular cone with height h, lower base radius R, and top radius r -r- --R
-
The 5 sequence for the mRNA for E. coli ribosomal L10 protein is shown below. Identify the ShineDalgarno sequence and the initiator codon. 5CUACCAGGAGCAAAGCUAAUGGCUUUA3
-
A cryogenic fluid as liquid nitrogen at 90 K, 400 kPa flows into a probe used in cryogenic surgery. In the return line the nitrogen is then at 160 K, 400 kPa. Find the specific heat transfer to the...
-
A small stream with 20oC water runs out over a cliff creating a 100 m tall waterfall. Estimate the downstream temperature when you neglect the horizontal flow velocities upstream and downstream from...
-
A small water pump is used in an irrigation system. The pump takes water in from a river at 10oC, 100 kPa at a rate of 5 kg/s. The exit line enters a pipe that goes up to an elevation 20 m above the...
-
What are the vulnerabilities of embedded operating systems, such as, but not limited to, IoT devices, programmable logic devices, and vehicle control systems.
-
Factor the polynomial completely. 7x-17x-12
-
What are some relevant recommendations about Coca-Cola's Planning, Design, and Implementation of an Enterprise Resource Planning System that other companies can apply to their own initiatives?
Study smarter with the SolutionInn App