Discuss the major differences among allopatric, parapatric, and sympatric speciation.
Question:
Fantastic news! We've Found the answer you've been seeking!
Step by Step Answer:
Answer rating: 60% (10 reviews)
Allopatric speciation involves a physical separation of a species into two or more separate populati...View the full answer
Answered By
Pushpinder Singh
Currently, I am PhD scholar with Indian Statistical problem, working in applied statistics and real life data problems. I have done several projects in Statistics especially Time Series data analysis, Regression Techniques.
I am Master in Statistics from Indian Institute of Technology, Kanpur.
I have been teaching students for various University entrance exams and passing grades in Graduation and Post-Graduation.I have expertise in solving problems in Statistics for more than 2 years now.I am a subject expert in Statistics with Assignmentpedia.com.
4.40+
3+ Reviews
10+ Question Solved
Related Book For
Question Posted:
Students also viewed these Biology questions
-
What are the major differences among nematodes, cestodes, and trematodes?
-
Discuss the differences among sex-influenced, sex-limited, and sex-linked inheritance. Give examples.
-
Discuss the advantages of the genetic analysis of bacteria and bacteriophages. Make a list of the types of allelic differences among bacteria and phages that are suitable for genetic analyses.
-
After the car reaches 1 0 0 km / hthe driver immediately steps on the brakes and comes to a stop in 2 . 5 5 s . The brakes are at a distance 1 5 . 9 cm from the center of the wheel and the force they...
-
Adam and Eve consume only apples. Of the following allocations of apples, which are preferred to which others according to (a) the Pareto criterion, and (b) the efficiency criterion? a. Adam has 12...
-
1. What strategic mistakes did Nokia make in the U.S. market? 2. Why do you think a smart company makes dumb mistakes? 3. What strategies is Nokia using to revitalize its North American business? 4....
-
What is a lifting machine? Give exaples.
-
Preparing a consolidated balance sheet. The first two columns of Exhibit 13.14 present information from the accounting records of Company P and Company S on December 31, 2009. Company P acquired l00%...
-
You recently overheard that your company's competitors have started to purchase their materials from an online marketplace. You identify your company's top three products and collect information...
-
Figure 9.5 is a copy of the auditors working paper for auditing accounts receivable balances for the client New Millennium Ecoproducts. It shows the details of the cut-off tests. Required a. Find the...
-
Discuss whether the phenomenon of reproductive isolation applies to bacteria, which reproduce asexually. How would a geneticist divide bacteria into separate species?
-
The following are two DNA sequences from homologous genes: TTGCATAGGCATACCGTATGATATCGAAAACTAGAAAAATAGGGCGATAGCTAGTATGTTATCGAAAAGTAGCAAAATAGGGCGATAGCTACCCAGACTACCGGAT The two sequences, however, do...
-
Calculate the number of moles of solute in (a) 238 mL of a 0.211 M NaBr solution. (b) 1.2 L of a 0.077 M solution of ammonium chloride.
-
A person doing a chin-up weighs 533.8 N, disregarding the weight of the arms. During the first 24.7 cm of the lift, each arm exerts an upward force of 388 N on the torso. The acceleration of gravity...
-
Consider a company, at the beginning of October, with the following raw materials in the warehouse: Material X Y Z Quantity (Kg) Concept Material X Material Z These materials, whose price are...
-
A ( n ) _ _ _ _ _ _ _ _ _ technique checks all possible choices for a solution. Question 3 options: indirect recursion exhaustive recursion mutual recursion brute - force
-
QUESTION An extract from Pangu Pakavu Plc statement of comprehensive income for the year ended 31st December 2014 is as follows: TZS '000 Revenue Cost of sales Gross profit Other expenses Profit from...
-
Under the equal protection and due process clauses of the U.S. Constitution business entities are considered persons non-entities O limited purpose public figures O corporations
-
Name each of the following compounds. Assume the acids are dissolved in water. a. HCHO b. NH4NO c. CoS3 d. ICI e. Pb3(PO4)2 f. KClO3 g. HSO4 h. Sr3N i. j. SnO k. NaCRO4 I. HCIO Al2(SO3)3
-
A test car is driven a fixed distance of n miles along a straight highway. (Here n Z+.) The car travels at one mile per hour for the first mile, two miles per hour for the second mile, four miles...
-
What are risk and risk assessment?
-
What is one way that scientists determine whether a chemical causes cancer? What are two problems with this method?
-
What are three ways that chemical mixtures interact?
-
1. How many degrees Celsius does the temperature decrease when there is a 45.8F decrease in temperature? 2. For each 1.00F change in temperature what is the corresponding change in degrees Celsius?...
-
A proton (mass of 1.67 x 10-27 kg) is moving at 1.25 x 106 m/s directly toward a stationary helium nucleus (mass 6.64 x 10-27 kg). After a head-on elastic collision, what is the velocity of the...
-
The December 31, Year 4, balance sheet for Vernon Corporation is presented here. These are the only accounts on Vernon's balan sheet. Amounts indicated by question marks (?) can be calculated using...
Study smarter with the SolutionInn App