Each of the following pairs of primers has a problem with it. Tell why the primers would

Question:

Each of the following pairs of primers has a problem with it. Tell why the primers would not work well.

(a) Forward primer 5' GCCTCCGGAGACCCATTGG 3'

Reverse primer 5' TTCTAAGAAACTGTTAAGG 3'

(b) Forward primer 5' GGGGCCCCTCACTCGGGGCCCC 3'

Reverse primer 5' TCGGCGGCCGTGGCCGAGGCAG 3'

Reverse primer 5' CGGACCTTCATTGGCAATTCGA 3'

Fantastic news! We've Found the answer you've been seeking!

Step by Step Answer:

Related Book For book-img-for-question

Biochemistry

ISBN: 978-1285429106

8th edition

Authors: Mary K. Campbell, Shawn O. Farrell

See More Books

Question Posted: Jul 08, 2015 01:16 PM

See More Questions

Each of the following pairs of compounds undergoes a Bronsted acid-base reaction for which the equilibrium lies to the right. Give the products of each reaction, and identify the acid, the base, the...
Each of the following pairs of compounds undergoes a Bronsted acidbase reaction for which the equilibrium lies to the right. Give the products of each reaction, and identify the acid, the base, the...
A presidential candidate fears he has a problem with women voters. His campaign staff plans to run a poll to assess the situation. They'll randomly sample 300 men and 300 women, asking if they have a...
How are the square numbers embedded in Pascals triangle?
General American Investors Company, a closed-end regulated investment management company, invests primarily in medium- and high-quality stocks. Jim Campbell is studying the asset value per share for...
Part A For the following use the company Williams-Sonoma (WSM) 1. Assume that the company's sales are expected to grow 5% per year for the next 5 years. EBIT margin per year will remain constant...
We consider automobile injury claims data using data from the Insurance Research Council (IRC), a division of the American Institute for Chartered Property Casualty Underwriters and the Insurance...
The balance in the prepaid insurance account, before adjustment at the end of the year, is $6,175. Journalize the adjusting entry required under each of the following alternatives for determining the...
If price were set at $300 this market, how many units of the good would be sold? Will any of those units be sold to consumers who are willing to pay more than $300? Will any of those units be sold to...
You have $1,924,190 in your TFSA today. Every two weeks (26 times a year) $125 will be automatically deposited to your TFSA starting two weeks from now. How many YEARS will to take to reach $50,000...
What are the criteria for good primers in a PCR reaction?
What is the functional difference between regular PCR and qPCCR?
Answer Q 13-27, but assume that you report under IFRS.
create dataFrame of Sharpe ratio in 2020 and (B) dataFrame of Sharpe ratio in 2021. Then merge (A) dataFrame of Sharpe ratio in 2020 and (B) dataFrame of Sharpe ratio in 2020. The merged keys should...
Determine if the following actions affect the size of M1 and/or M2. Items (6 items) (Drag and drop into the appropriate area below) Barbara closes out her $5,000 time deposit and gets cash.Hillary...
For the data x1 x2 y 1 2 3.1 2 4 5.9 3 5 8.1 4 3 7.3 (i) Derive using the OLS the estimators of the parameters of the linear regression model y = 0 + 1 x 1 + 2 x 2 . Show the complete derivation...
Which allows consumers to lock up their credit reports to protect their credit records from identity thieves who use stolen information to open new accounts in their victims' names?
Carlos leases copy machines to small and large businesses. How might he use accounting information on a day-to-day basis?
Profit prior to incorporation is A. Debited to Goodwill Account B. Credited to General Reserve Account C. Credited to Capital Reserve Account
Global.asax is used for: a. declare application variables O b. all other answers are wrong O c. declare global variables O d. handle application events
Can modification of enzymes of aerobic glycolysis play a role in cancer treatment?
What is the metabolic advantage in the conversion of glucose to lactate, in which there is no net oxidation or reduction?
Most hunters know that meat from animals that have been run to death tastes sour. Suggest a reason for this observation.
1. (25 points) Consider the following programs: Alg1(n): For i 1 to n For j = 1 to n If i+j
Convert the following C code into an ARM assembly program: void main(void) { } Hint: short a[8] = {1, 3, 5, 7, 9, 11, 13, 15}; short b[8] = {2, 4, 6, 8,10, 12, 14, 16}; short c[8] = {0, 0, 0, 0, 0,...
7. Consider the following code. Modify the classes to make sure the main() function compiles and runs without any error. (Hint: you should implement 2 or 3 functions.) [ < < 15 min] [3pt] 1. #include...

Each of the following pairs of primers has a problem with it. Tell why the primers would

Question:

Step by Step Answer:

a The primers have very different GC content...View the full answer

Biochemistry

Students also viewed these Medical Sciences questions