
Each of the following pairs of primers has a problem with it. Tell why the primers would not work well.
(a) Forward primer 5' GCCTCCGGAGACCCATTGG 3'
Reverse primer 5' TTCTAAGAAACTGTTAAGG 3'
(b) Forward primer 5' GGGGCCCCTCACTCGGGGCCCC 3'
(c) Forward primer 5' TCGAATTGCCAATGAAGGTCCG 3'

  • CreatedJuly 08, 2015
  • Files Included
Post your question