Each of the following pairs of primers has a problem
Each of the following pairs of primers has a problem with it. Tell why the primers would not work well.
(a) Forward primer 5' GCCTCCGGAGACCCATTGG 3'
Reverse primer 5' TTCTAAGAAACTGTTAAGG 3'
(b) Forward primer 5' GGGGCCCCTCACTCGGGGCCCC 3'
Reverse primer 5' TCGGCGGCCGTGGCCGAGGCAG 3'
(c) Forward primer 5' TCGAATTGCCAATGAAGGTCCG 3'
Reverse primer 5' CGGACCTTCATTGGCAATTCGA 3'
Membership TRY NOW
  • Access to 800,000+ Textbook Solutions
  • Ask any question from 24/7 available
    Tutors
  • Live Video Consultation with Tutors
  • 50,000+ Answers by Tutors
OR
Relevant Tutors available to help