Question: Each of the following pairs of primers has a problem

Each of the following pairs of primers has a problem with it. Tell why the primers would not work well.
(a) Forward primer 5' GCCTCCGGAGACCCATTGG 3'
Reverse primer 5' TTCTAAGAAACTGTTAAGG 3'
(b) Forward primer 5' GGGGCCCCTCACTCGGGGCCCC 3'
(c) Forward primer 5' TCGAATTGCCAATGAAGGTCCG 3'

View Solution:

Sale on SolutionInn
  • CreatedJuly 08, 2015
  • Files Included
Post your question