Question: Each of the following pairs of primers has a problem

Each of the following pairs of primers has a problem with it. Tell why the primers would not work well.
(a) Forward primer 5' GCCTCCGGAGACCCATTGG 3'
Reverse primer 5' TTCTAAGAAACTGTTAAGG 3'
(b) Forward primer 5' GGGGCCCCTCACTCGGGGCCCC 3'
Reverse primer 5' TCGGCGGCCGTGGCCGAGGCAG 3'
(c) Forward primer 5' TCGAATTGCCAATGAAGGTCCG 3'
Reverse primer 5' CGGACCTTCATTGGCAATTCGA 3'


$1.99
Sales0
Views56
Comments
  • CreatedJuly 08, 2015
  • Files Included
Post your question
5000