Partial Frisch and Waugh in the least squares regression of y on a constant and X, to
Question:
Partial Frisch and Waugh in the least squares regression of y on a constant and X, to compute the regression coefficients on X, we can first transform y to deviations from the mean y and, likewise, transform each column of X to deviations from the respective column mean; second, regress the transformed y on the transformed X without a constant. Do we get the same result if we only transform y? What if we only transform X?
Fantastic news! We've Found the answer you've been seeking!
Step by Step Answer:
Answer rating: 63% (11 reviews)
In the least squares regression of y on a constant and X in order to compute the regression coeffici...View the full answer
Answered By
MICHAEL KICHE
I was employed studypool for the first time in tutoring. I did well since most of my students and clients got the necessary information and knowledge requested for. I always submitted the answers in time and followed the correct formatting in answering eg MLA or APA format,
Again I worked with the writers bay where I did writing and got many clients whom we worked with so closely. They enjoyed every single service I delivered to them. My answers are always correct.
4.70+
13+ Reviews
53+ Question Solved
Related Book For
Question Posted:
Students also viewed these Econometric questions
-
In the least squares regression of y on a constant and X, to compute the regression coefficients on X, we can first transform y to deviations from the mean y and, likewise, transform each column of X...
-
A multiple regression of y on a constant x 1 and x 2 produces the following results: y = 4 + 0.4x 1 + 0.9x 2 , R 2 = 8/60, e'e = 520, n = 29, Test the hypothesis that the two slopes sum to 1. [29 0 0...
-
A multiple regression of y on a constant x1 and x2 produces the following results: y = 4 + 0.4x1 + 0.9x2. R2 = 8/60, e' e = 520, n = 29, Test the hypothesis that the two slopes sum to 1. [29 0 X'X...
-
A city starts a solid waste landfill in 2012. When the landfill was opened the city estimated that it would fill to capacity within 5 years and that the cost to cover the facility would be $1.5...
-
Venture capitalists and many angel investors are often actively involved with the ventures in which they invest. How does this benefit the entrepreneur? Does this benefit the venture capitalist and...
-
Stephens, Atkins, and Kingston (2009) conducted a research study demonstrating that swearing can help reduce pain. In the study, each participant was asked to plunge a hand into icy water and keep it...
-
Express the stress-strain relationships in Equation 2.37 in terms of offaxis engineering constants such as the moduli of elasticity, shear modulus, Poisson's ratios, and shear-coupling ratios. 3 Ex...
-
Tim Trepid is highly risk-averse, while Mike Macho actually enjoys taking a risk. a. Which one of the four investments should Tim choose? Compute coefficients of variation to help you in your choice....
-
A steam turbine having an isentropic turbine efficiency of 90% drives an air compressor having an isentropic compressor efficiency of 85%. Steady-state operating data are provided on the figure....
-
A bridge girder AB on a simple span of length L = 14 m supports a distributed load of maximum intensity q at mid span and minimum intensity q/2 at supports A and B that includes the weight of the...
-
Linear Transformations of the data, consider the least squares regression of y on K variables (with a constant) X. Consider an alternative set of regressors Z = XP, where P is a nonsingular matrix....
-
A residual maker what is the result of the matrix productM1MwhereM1 is defined in (3-19) and M is defined in (3-14)?
-
Briefly discuss each of the following economic ideas: People are rational, people respond to economic incentives, and optimal decisions are made at the margin?
-
An advantage of translesion-replicating polymerases is that they can replicate _________________, but a disadvantage is that they _________________. a. very quickly, have low fidelity b. over damaged...
-
In one PCR cycle, the correct order of steps is a. primer annealing, primer extension, denaturation. b. primer annealing, denaturation, primer extension. c. denaturation, primer annealing, primer...
-
If an abnormal repressor protein could still bind allolactose but the binding of allolactose did not alter the conformation of lac repressor, how would the expression of the lac operon be affected?
-
A portion of the coding sequence of a cloned gene is shown here: 5GCCCCCGATCTACATCATTACGGCGAT3 3CGGGGGCTAGATGTAGTAATGCCGCTA5 This portion of the gene encodes a polypeptide with the amino acid...
-
Following the infection of healthy tobacco leaves by reconstituted viruses, what two characteristics did Fraenkel-Conrat and Singer analyze? Explain how their results were consistent with the idea...
-
A typical wind turbine extracts 40% of the kinetic energy of the wind that blows through the area swept by the blades. For a large turbine, 110,000 kg of air moves past the blades at 15 m/s every...
-
AB CORPORATION ISSUED THE FOLLOWING 850 COMMON STOCKS PAR VALUE P100 750 PARTICIPATING PREFERRED STOCKS PAR VALUE P100 AT 3% AB CORPORATION DECLARED P100,000.00 DIVIDEND IN 2022.
-
What do the neoclassical economists have to say about taxes? How do taxes interfere with the individual?
-
For the model in (5-25) and (5-26), prove that when only x* is measured with error, the squared correlation between y and x is less than that between y* and x*. (Note the assumption that y* = y.)...
-
Christensen and Greene (1976) estimated a generalized Cobb??Douglas cost function of the form ln(C/Pf) = + ln Q + (ln2 Q)/2 + k ln(Pk/Pf) + 1 ln(Pl/Pf) + . Pk, Pl and Pf indicate unit prices of...
-
The consumption function used in Example 5.3 is a very simple specification. One might wonder if the meager specification of the model could help explain the finding in the Hausman test. The data set...
-
The Clifford Corporation has announced a rights offer to raise $36 million. The stock currently sells for $28 per share and there are 18 million shares outstanding. If the subscription price is set...
-
Superman Enterprises has just completed an initial public offering. The firm sold 4,700,000 new shares at an offer price of $17.00 per share. The underwritering spread was $0.78 a share. The firm...
-
ABV is a non-dividend paying stock whose current price is $50. Its volatility is 12%. Over each of the next two 6-month periods the stock price is expected to go up by 9% or down by 8%. The risk-free...
Study smarter with the SolutionInn App