Ribosomal proteins have high pI values. Why is this advantageous for ribosome stability?

Question:

Fantastic news! We've Found the answer you've been seeking!

Step by Step Answer:

Related Book For answer-question

Biochemistry Concepts And Connections

ISBN: 9780134641621

2nd Edition

Authors: Dean Appling, Spencer Anthony-Cahill, Christopher Mathews

See More Books

Question Posted: Nov 06, 2023 03:18 AM

See More Questions

In eukaryotes, the three RNA polymerases, Pol I, II, and III, each transcribes unique genes required for the synthesis of ribosomes: 25S and 18S rRNAs (Pol 1), 55 rRNA (Pol III), and mRNAs for...
Proteins are synthesized with a particular amino acid sequence through the translation of information encoded in messenger RNA by an RNAprotein complex called a ribosome. Amino acids are specified by...
A protein has a molecular mass of 400 kDa when measured by gel filtration. When subjected to gel electrophoresis in the presence of sodium dodecyl sulfate (SDS), the protein gives three bands with...
What are some ways that the antibody-protein complex can be visualized in ELISA or western blots?
Imelda is making equal-sized monthly payments of $288 on her car loan. She has only 18 payments left. Each month, the portion of her payment that goes to pay interest and the portion that goes to...
Suppose your friend tells you, My colleague offered me $200 to rent my boat over the weekend, but I decided that I would use it myself to go water skiing at a cost of $90. What costs are involved in...
Why is an ethical culture considered necessary for fraud prevention and deterrence?
Norman Concrete Company pours concrete slabs for single-family dwellings. Wayne Construction Company, which operates outside Normans normal sales territory, asks Norman to pour 40 slabs for Waynes...
Problem 5. [20 pts] Verify Green's Theorem for the following vector field and region D. Namely, compute both, the line integral and the double integral. x1 1. (10pts) F (1,-1). and D is the square...
The 5 sequence for the mRNA for E. coli ribosomal L10 protein is shown below. Identify the ShineDalgarno sequence and the initiator codon. 5CUACCAGGAGCAAAGCUAAUGGCUUUA3
The earliest work on the genetic code established UUU, CCC, and AAA as the codons for Phe, Pro, and Lys, respectively. Can you think of a reason why polyG was not used as a translation template in...
Why do we analyze the average-case performance of a randomized algorithm and not its worst-case performance?
Barry and Connie Rawles, husband and wife, are both age 34 and have two sons. Barry earned $51,000 and Connie earned $45,000 during 2019. Barry and Connie paid $4,200 state income taxes, $12,000...
Wayne Wyatt exchanges business land with an adjusted basis of $300,000 and a fair market value of $600,000 for Fred Forbess office building, worth $500,000, and $100,000 cash. Fred had an adjusted...
What is Section 1250 property?
Oscar Olson, single, purchased a residence on February 19, 2017, for $170,000. On September 7, 2019, a tornado completely destroyed his home. The home was insured for its replacement value, and homes...
What is Section 1245 property? What is the Section 1245 recapture rule?
Yoric Company listed the net changes in its balance sheet accounts for the past year as follows: The following additional information is available about last years activities: a. Net income for the...
For the data in Exercise 17-19, use the FIFO method to summarize total costs to account for, and assign these costs to units completed and transferred out, and to units in ending work in process....
What are micro RNAs?
What are small nuclear RNAs?
What are some key differences in how mRNA is processed in prokaryotes versus eukaryotes?
Consider the linear program min x1 + x2 s.t. x1 x21, x1, x2 0. a) Determine all solutions of (2). b) Transform (2) into standard form. c) For 70 determine the solution (XT, YT, ST) of the central...
How would you/how does your organization assess a contract to ensure that you can meet the requirements of a contract? How do you evaluate a contract prior to bidding on it? By leveraging external...
Identify someone who you consider as an excellent leader.What type of leadership style(s)does he/she exhibit? What conflict management toolcana leader use to diffuse conflict(s) in an organization?...

Ribosomal proteins have high pI values. Why is this advantageous for ribosome stability?

Question:

Step by Step Answer:

Ribosomal proteins having high isoelectric point pI values can be advantageous for ribosome stability due to several reasons Maintenance of Ribosome S...View the full answer

Biochemistry Concepts And Connections

Students also viewed these Sciences questions