The fact that DNA sequences are more similar in more closely related organisms is evidence of what?
Question:
The fact that DNA sequences are more similar in more closely related organisms is evidence of what?
a. Optimal design in organisms
b. Adaptation
c. Mutation
d. Descent with modification
Fantastic news! We've Found the answer you've been seeking!
Step by Step Answer:
Answer rating: 75% (12 reviews)
So when you analyze DNA and see the ...View the full answer
Answered By
Marvine Ekina
Marvine Ekina
Dedicated and experienced Academic Tutor with a proven track record for helping students to improve their academic performance. Adept at evaluating students and creating learning plans based on their strengths and weaknesses. Bringing forth a devotion to education and helping others to achieve their academic and life goals.
PERSONAL INFORMATION
Address: , ,
Nationality:
Driving License:
Hobbies: reading
SKILLS
????? Problem Solving Skills
????? Predictive Modeling
????? Customer Service Skills
????? Creative Problem Solving Skills
????? Strong Analytical Skills
????? Project Management Skills
????? Multitasking Skills
????? Leadership Skills
????? Curriculum Development
????? Excellent Communication Skills
????? SAT Prep
????? Knowledge of Educational Philosophies
????? Informal and Formal Assessments
0.00
0 Reviews
10+ Question Solved
Related Book For
Concepts Of Biology
ISBN: 9781938168116
1st Edition
Authors: Samantha Fowler, Rebecca Roush, James Wise
Question Posted:
Students also viewed these Life Sciences questions
-
Are individual stock returns more closely related to national or industry factors? What implication does this have for portfolio diversification?
-
In the pairs of DNA sequences below, the lower duplex represents a mutagenized daughter duplex. Identify the mutation as a transition, a transversion, an insertion, or a deletion. (a) (b) 5'...
-
The following are two DNA sequences from homologous genes: TTGCATAGGCATACCGTATGATATCGAAAACTAGAAAAATAGGGCGATAGCTAGTATGTTATCGAAAAGTAGCAAAATAGGGCGATAGCTACCCAGACTACCGGAT The two sequences, however, do...
-
A company has the following results for the three accounting periods to 31 March 2021: Assuming that all possible claims are made to relieve the trading loss against total profits, calculate the...
-
The costs of inspection for five product attributes A, B, C, D, and E are $10, $5, $4, $2, and $12, respectively. The cost of failure for each attribute is estimated to be $25 for A, $15 for B, $30...
-
Turbine blades mounted to a rotating disc in a gas turbine engine are exposed to a gas stream that is at T = 1200C and maintains a convection coefficient of h = 250 W/m2 K over the blade. The...
-
What does relevance mean in the context of discovery?
-
When Brunos basis in his LLC interest is $150,000, he receives cash of $55,000, a proportionate share of inventory, and land in a distribution that liquidates both the LLC and his entire LLC...
-
CONFIDENTIAL FEBRUARY 2020/ASSIGNMENT2/PFN3193 As a broker to one of the client, you have decided to invest common stock that includes various types of industry in Malaysia Client's Profile 1. Age...
-
Recently Santa Fe, New Mexico, was named one of the safest places to live in the United States. Since then, housing development projects have been springing up all around Santa Fe. Six housing...
-
Which situation would most likely lead to allopatric speciation? a. A flood causes the formation of a new lake. b. A storm causes several large trees to fall down. c. A mutation causes a new trait to...
-
The wing of a bird and the arm of a human are examples of ________. a. Vestigial structures b. Molecular structures c. Homologous structures d. Analogous structures
-
In a 2009 study reported in the New England Journal of Medicine, Boyer et al. randomly assigned children aged 6 months to 18 years who had nonlethal scorpion stings to receive an experimental...
-
Explain any weaknesses of Good to Great: Why Some Companies Make the Leap.. and Others Don't by Jim Collins and your recommendations for eliminating such weaknesses.
-
5. Here is the code (in Python) for the left rotation in an AVL tree: def rotate Left (root: Node) -> Node: Right LeftSubtree = Right Child.leftchild RightChild = root right child Right Child. left...
-
What are the implications of cultural variations in emotional display rules, emotion perception norms, and emotional expression styles for the assessment and development of emotional intelligence...
-
Consider the following implementation of an iterative method: from numpy import cos, sin, log. x = 0.5 err = abs (cos(x)+log(x)) while err > 1e-6: dx = (cos(x)+log(x))/(-sin(x) +1/x) x += - dx err =...
-
Suppose the 2's complement representation of x is (a 32-bit word is used): 11111111111111111111111111101001 What is the value of x? Give your answer in decimal representation. Explain why your method...
-
Why is it important for the Chinese yuan to become a major world currency?
-
What is EBIT/eps analysis? What information does it provide managers?
-
RNA was extracted from TMV (tobacco mosaic virus) particles and found to contain 20 percent cytosine (20 percent of the bases were cytosine). With this information, is it possible to predict what...
-
DNA was extracted from cells of Staphylococcus afermentans and analyzed for base composition. It was found that 37 percent of the bases are cytosine. With this information, is it possible to predict...
-
If one strand of DNA in the WatsonCrick double helixhas a base sequence of 5-GTCATGAC-3, what is the base sequence of the complementary strand?
-
If a bank savings account with $ 2 , 4 1 0 will be worth $ 3 , 9 2 1 in 2 years, and if the interest rate is constant, what is the interest rate quote that the bank would post in its window?
-
Solve x2-24x+14= 0
-
- A two-dimensional vector makes an angle of 0 = 68.3 and has an x-component of 39.1 meters. Calculate the magnitude of this two- dimensional vector. Please enter a numerical answer below. Accepted...
Study smarter with the SolutionInn App