How can one magma body produce many different kinds of igneous rocks?
Question:
How can one magma body produce many different kinds of igneous rocks?
Fantastic news! We've Found the answer you've been seeking!
Step by Step Answer:
Answer rating: 100% (QA)
One magma body can produce many different kinds of igneous rocks through processes such as fractional crystallization assimilation magma mixing and ma...View the full answer
Answered By
Asim farooq
I have done MS finance and expertise in the field of Accounting, finance, cost accounting, security analysis and portfolio management and management, MS office is at my fingertips, I want my client to take advantage of my practical knowledge. I have been mentoring my client on a freelancer website from last two years, Currently I am working in Telecom company as a financial analyst and before that working as an accountant with Pepsi for one year. I also join a nonprofit organization as a finance assistant to my job duties are making payment to client after tax calculation, I have started my professional career from teaching I was teaching to a master's level student for two years in the evening.
My Expert Service
Financial accounting, Financial management, Cost accounting, Human resource management, Business communication and report writing. Financial accounting : • Journal entries • Financial statements including balance sheet, Profit & Loss account, Cash flow statement • Adjustment entries • Ratio analysis • Accounting concepts • Single entry accounting • Double entry accounting • Bills of exchange • Bank reconciliation statements Cost accounting : • Budgeting • Job order costing • Process costing • Cost of goods sold Financial management : • Capital budgeting • Net Present Value (NPV) • Internal Rate of Return (IRR) • Payback period • Discounted cash flows • Financial analysis • Capital assets pricing model • Simple interest, Compound interest & annuities
4.40+
65+ Reviews
86+ Question Solved
Related Book For
Conceptual Integrated Science
ISBN: 9780321818508
2nd Edition
Authors: Paul G Hewitt, Suzanne A Lyons
Question Posted:
Students also viewed these Physics questions
-
1. Weathering and erosion, the processes which break down and destroy rocks, have removed portions of the rock record. Also, there are periods of geological time where no rock record was made, as...
-
Introduction The geomorphology of Earths surface evolves over time through various processes. Sometimes small, incremental changes add up to significant differences over time. At other times large...
-
Read and answer the question below. EMBRACE DEMOGRAPHICS AND SOCIETAL CHANGES Using Differences to Drive Value Force 7: Demographics and Societal Changes. One of the most important forces that is...
-
The following questions deal with the topics of internal controls and audit strategies. Required: Select and justify the audit strategy you would choose in each of the following situations. Comment...
-
For each ratio listed, identify whether the change in ratio value from 2016 to 2017 is usually regarded as favorable or unfavorable. 2017 2016 8% 42% Ratio Ratio 2017 2016 1. Profit margin. 9% 47%...
-
Motomation Pty Ltd plans to acquire several retail automotive parts stores as part of its expansion program. Motomation carries out en extensive review of possible acquisitions prior to making any...
-
A current-carrying wire has been bent into the form shown in Figure P28.74, with a half-circle of radius \(R_{1}\) lying in the \(x y\) plane connected via two straight segments to a half-circle of...
-
a. Use the historical and projected financial data provided to prepare a pro forma income statement for the year ended December 31, 2010. (Use the percent- of-sales method to estimate all values...
-
1 Define Management? Explain its features, importance and nature? 2 Briefly explain about functions of management 3 Define leadership and explain leadership styles? 4 Briefly explain about decision...
-
Why are quartz and diamond so much harder than gold?
-
How is the magma that crystallizes to make rhyolite different from the parent magma of basalt?
-
If you work as a manager for a company with a human resources department, does this mean that you dont have to orient and train employees? Explain.
-
A researcher identified a mutation in PR of phage that causes its transcription rate to be increased 10-fold. Do you think this mutation would favor the lytic or lysogenic cycle? Explain your answer.
-
An advantage of translesion-replicating polymerases is that they can replicate _________________, but a disadvantage is that they _________________. a. very quickly, have low fidelity b. over damaged...
-
In one PCR cycle, the correct order of steps is a. primer annealing, primer extension, denaturation. b. primer annealing, denaturation, primer extension. c. denaturation, primer annealing, primer...
-
If an abnormal repressor protein could still bind allolactose but the binding of allolactose did not alter the conformation of lac repressor, how would the expression of the lac operon be affected?
-
A portion of the coding sequence of a cloned gene is shown here: 5GCCCCCGATCTACATCATTACGGCGAT3 3CGGGGGCTAGATGTAGTAATGCCGCTA5 This portion of the gene encodes a polypeptide with the amino acid...
-
What is the essential difference between message switching and packet switching?
-
You have just begun your summer internship at Omni Instruments. The company supplies sterilized surgical instruments for physicians. To expand sales, Omni is considering paying a commission to its...
-
QUESTION THREE (a) (b) Joseph intends to start a small business specializing in software development to cater for the youth; however a business consultant has advised him to be extra careful before...
-
(a) During the audit of the Weak Bank (W), RBI has suggested that the Bank should either merge with another bank or may close down. Strong Bank (S) has submitted a proposal of merger of Weak Bank...
-
(a) A Ltd. has issued convertible bonds, which carries a coupon rate of 14%. Each bond is convertible into 20 equity shares of the company A Ltd. The prevailing interest rate for similar credit...
Study smarter with the SolutionInn App