The p K value for N1 of adenine is 3.64, whereas the p K value for N1
Question:
The pK value for N1 of adenine is 3.64, whereas the pK value for N1 of guanine is 9.50. Explain this difference.
Fantastic news! We've Found the answer you've been seeking!
Step by Step Answer:
Answer rating: 33% (3 reviews)
The difference in pK negative logarithm of the acid dissociation constant values for N1 of adenine a...View the full answer
Answered By
Ajeet Singh
Hi there! Are you looking for a committed, reliable, and enthusiastic tutor? Well, teaching and learning are more of a second nature to me, having been raised by parents who are both teachers. I have done plenty of studying and lots of learning on many exciting and challenging topics. All these experiences have influenced my decision to take on the teaching role in various capacities. As a tutor, I am looking forward to getting to understand your needs and helping you achieve your academic goals. I'm highly flexible and contactable. I am available to work on short notice since I only prefer to work with very small and select groups of students. Areas of interest: Business, accounting, Project management, sociology, technology, computers, English, linguistics, media, philosophy, political science, statistics, data science, Excel, psychology, art, history, health education, gender studies, cultural studies, ethics, religion. I am also decent with math(s) & Programming. If you have a project you think I can take on, please feel welcome to invite me, and I'm going to check it out!
5.00+
4+ Reviews
24+ Question Solved
Related Book For
Fundamentals Of Biochemistry Life At The Molecular Level
ISBN: 9781118918401
5th Edition
Authors: Donald Voet, Judith G Voet, Charlotte W Pratt
Question Posted:
Students also viewed these Sciences questions
-
Use your answer to Problem 27 to determine the relative pK values of N3 in cytosine and in uracil. Data from Problem 27: The pK value for N1 of adenine is 3.64, whereas the pK value for N1 of guanine...
-
Adenine can be deaminated to hypoxanthine, and guanine can be deaminated to xanthine. Draw structures for hypoxanthine and xanthine.
-
The following table gives the systolic blood pressure (SBP), body size (QUET), age (AGE), and smoking history (SMK = 0 if a nonsmoker, SMK = 1 if a current or previous smoker) for a hypothetical...
-
Mango Designs began selling its custom furniture on June 1, 2020. At the end of the month, the special journals showed the following results. Other information you will need is as follows: ? Interest...
-
Cool-Aire Corporation manufactures a line of room air conditioners. Its breakeven sales level is 33,000 units. Sales are approximately normally distributed. Expected sales next year are 40,000 units...
-
A steel rod of 15-mm diameter is held snugly (but without any initial stresses) between rigid walls by the arrangement shown in the figure. (For the steel rod, use α =12 à 106 /...
-
How long does it take an ambulance to respond to a request for emergency medical aid? One of the goals of one study was to estimate the response time of ambulances using warning lights (Ho \&...
-
Barnes Industries had the following transactions. 1. Borrowed $5,000 from the bank by signing a note. 2. Paid $3,100 cash for a computer. 3. Purchased $850 of supplies on account. Instructions (a)...
-
Analyze your favorite company's and its main competitor's Facebook and perform a competitive content analysis, specifically the type of content they publish. You will quickly learn that not all...
-
Write the sequences of the two 12-residue primers that could be used to amplify the following DNA segment by PCR. ATAGGCATAGGCCCATATGGCATA AGGCTTTATAATAT- GCGATAGGCGCTGGTCAG
-
Would the modified nucleoside described in Question 23 be able to participate in standard WatsonCrick base pairing? Data from Question 23: Some RNA molecules are covalently modified by methylation at...
-
Why do you think the most actively traded options tend to be the ones that are near the money?
-
To make a batch of 1,000 units, it is estimated that 120 direct labor hours are required at a cost of \($10\) per hour. Direct material costs are estimated at \($1,500\) per batch. The overhead costs...
-
True or False: If independent, indivisible investments 3 and 4 are mutually exclusive, then X 3 + X 4 < 1 is added as a constraint to the BLP formulation.
-
A relocation of a short stretch of rural highway feeding into Route 390 northwest of Dallas is to be made to accommodate new growth. The existing road is now unsafe, and improving it is not an...
-
A water distribution system using a new source of water is under consideration and found to have an unfortunately high net annual cost of \(\$ 5,750,000\) and net benefits of \(\$ 4,250,000\)....
-
A county commissioner has eight projects available as summarized below. The remaining budget for the year is \(\$ 243,000\) for new projects. Operating and maintenance costs are separately funded and...
-
Yamamoto Iron & Steel is considering setting up a minimill outside Atlanta, Georgia. At present, the company is planning to send a group of executives to the area to talk with local and state...
-
Charles owns an office building and land that are used in his trade or business. The office building and land were acquired in 1978 for $800,000 and $100,000, respectively. During the current year,...
-
Explain why single-nucleotide mutations in DNA occur at a constant rate, but the rate of protein evolution varies.
-
List possible ways to track the presence of a protein during its purification.
-
Rank the following residue positions in cytochrome c in order from least to most conserved: 56, 61, 74, 85, and 89.
-
Consider a vehicle with a 3-speed manual transmission. The corresponding fuel efficiency map of the engine is shown below. You are driving at a constant vehicle speed. The engine speed in each of the...
-
Solve these problems using the graphical method (on a separate sheet of paper). Clearly state your decision variable (DV), constraints, and objective function (OF). Remember your units. Assemble a...
-
A uniform rod is 1 m long and has a mass of 10 kg. It is pinned at point A, a frictionless pivot. The rod is released from a rest position 45 from the horizontal. The top of an undeflected ideal...
Study smarter with the SolutionInn App