What factors are considered in determining personal jurisdiction?
Question:
What factors are considered in determining personal jurisdiction?
Fantastic news! We've Found the answer you've been seeking!
Step by Step Answer:
Answer rating: 64% (14 reviews)
The factors that are considered in determining personal jurisdic...View the full answer
Answered By
Rodrigo Louie Rey
I started tutoring in college and have been doing it for about eight years now. I enjoy it because I love to help others learn and expand their understanding of the world. I thoroughly enjoy the "ah-ha" moments that my students have. Interests I enjoy hiking, kayaking, and spending time with my family and friends. Ideal Study Location I prefer to tutor in a quiet place so that my students can focus on what they are learning.
5.00+
1+ Reviews
10+ Question Solved
Related Book For
Law for Business
ISBN: 978-1259722325
13th edition
Authors: A. James Barnes, Terry M. Dworkin, Eric L. Richards
Question Posted:
Students also viewed these Business questions
-
Define market structure. What factors are considered in determining the market structure of a particular industry?
-
Discuss the fair use doctrine and what factors are considered in determining whether a use is fair.
-
Ketchikan Drywall Services (KDS) has four full time employees, and about 20 part-time employees, and hires additional employees as needed on a project-by-project basis. KDS requires applicants to...
-
Revenue for the new startup company "BCB Excavating" for the years 2017 through 2021 have been $543,000, $603,400, $789,000, $845,000, and $889,000 respectively. Year 2017 2018 2019 2020 2021 2022...
-
Obtain a copy of COBIT (available at www.isaca.org) and read section DS5. Design a checklist for assessing each of the 11 detailed information security control objectives. The checklist should...
-
In Problems 9-16, find the indicated matrices, if possible. \[[\mathrm{A}]=\left[\begin{array}{rr}1 & 2 \\4 & 0 \\-1 & 3 \\2 & 1 \end{array} ight] \quad[\mathrm{B}]=\left[\begin{array}{rr}4 & 2 \\-1...
-
The paint stirrer shown in Fig. P9.94 consists of two circular disks attached to the end of a thin rod that rotates at \(80 \mathrm{rpm}\). The specific gravity of the paint is \(S G=1.1\) and its...
-
Pryor Sales, Inc., is authorized to issue 190,000 shares of common stock and 10,000 shares of preferred stock. During its first year, the business completed the following stock issuance transactions:...
-
You have been offered a job by the Boulder Dry Company . The director of HR has asked you to singe a two page contract . What provisions seen totally unrelated to the main purpose?
-
Melodic Musical Sales, Inc. is located at 5500 Fourth Avenue, City, ST 98765. The corporation uses the calendar year and accrual basis for both book and tax purposes. It is engaged in the sale of...
-
What are the main advantages of using ADR over going to trial?
-
What is the plaintiffs burden of proof in a civil case? Who decides whether the plaintiff has met this burden?
-
The Befort Cozmpany filed for a patent on a new type of machine. The application costs totaled $12,000. R&D costs incurred to create the machine were $75,000. In the year in which the company filed...
-
An advantage of translesion-replicating polymerases is that they can replicate _________________, but a disadvantage is that they _________________. a. very quickly, have low fidelity b. over damaged...
-
In one PCR cycle, the correct order of steps is a. primer annealing, primer extension, denaturation. b. primer annealing, denaturation, primer extension. c. denaturation, primer annealing, primer...
-
If an abnormal repressor protein could still bind allolactose but the binding of allolactose did not alter the conformation of lac repressor, how would the expression of the lac operon be affected?
-
A portion of the coding sequence of a cloned gene is shown here: 5GCCCCCGATCTACATCATTACGGCGAT3 3CGGGGGCTAGATGTAGTAATGCCGCTA5 This portion of the gene encodes a polypeptide with the amino acid...
-
Following the infection of healthy tobacco leaves by reconstituted viruses, what two characteristics did Fraenkel-Conrat and Singer analyze? Explain how their results were consistent with the idea...
-
Determine the maximum allowable intensity w of the uniform distributed load that can be applied to the beam. Assume w passes through the centroid of the beams crosssectional area, and the beam is...
-
If the joint cost function for two products is C(x, y) = xy2 + 1 dollars (a) Find the marginal cost (function) with respect to x. (b) Find the marginal cost with respect to y.
-
Must such discrimination have been committed by the employer or can the discrimination have been committed by society in general? Explain.
-
Can race or gender be the only factor in an employment decision? Explain.
-
What is the difference between an affirmative action goal and a quota? Is there a difference? Explain.
-
Whatare basis of the segmentation? How would you improve on this strategy in marketing ? What are the basis of the segmentation? How would you improve on this strategy?
-
Jimmy has a bond with a $1,000 face value and a coupon rate of 9.5% paid semiannually. It has a five-year life. a) If investors are willing to accept a 14 percent rate of return on bonds of similar...
-
A zero-coupon bond that will pay $1,050 in 12 years is selling today for $441.91. What interest rate does the bond offer?
Study smarter with the SolutionInn App