Private ownership of most of the means of production is common to _______. a) capitalism and communism
Question:
Private ownership of most of the means of production is common to _______.
a) capitalism and communism
b) capitalism and fascism
c) capitalism and socialism
d) fascism and communism
Fantastic news! We've Found the answer you've been seeking!
Step by Step Answer:
Answer rating: 33% (3 reviews)
Private ownership of most of the means of production is common to ...View the full answer
Answered By
PALASH JHANWAR
I am a Chartered Accountant with AIR 45 in CA - IPCC. I am a Merit Holder ( B.Com ). The following is my educational details.
PLEASE ACCESS MY RESUME FROM THE FOLLOWING LINK: https://drive.google.com/file/d/1hYR1uch-ff6MRC_cDB07K6VqY9kQ3SFL/view?usp=sharing
3.80+
3+ Reviews
10+ Question Solved
Related Book For
Question Posted:
Students also viewed these Business questions
-
Case Study 2 (questions at the end of the document) By Colleen Haight Summer 2011, Stanford Social Innovation Review, Informing and Inspiring leaders of social change Jesus Lopez Hernandez picks ripe...
-
The more we learn about how fashion is created, the more we face a moral dilemma that pits our individual freedom of expression and purchasing power against both the environment and the dignity and...
-
Marx and Engels were two of the most important philosophers in history. Their influence is widely spread around the world to this day. Marx and Engels are deeply critical of the system of life that...
-
Consider a scenario, in which there were four students (Arthur, Kevin, Morris, and Orlando) driving their cars back home from Houston. However, only Orlando was involved in a car accident. We want to...
-
What is your definition of perception? Is it objective or subjective? Justify your answer.
-
Consider the simple regression model \(y_{i}=\beta_{1}+\beta_{2} x_{i 2}+e_{i}\). Suppose \(N=5\) and the values of \(x_{i 2}\) are \((1,2,3,4,5)\). Let the true values of the parameters be...
-
Why does average employee contribution offer a better estimate of the contribution of individuals to an organization than total compensation (wages, incentives, and benefits)?
-
The October 31 bank statement of Dunlap Engineering Associates has just arrived from Carolina First Bank. To prepare the Dunlap bank reconciliation, you gather the following data: a. Dunlaps Cash...
-
A distinction is often made between management accounting and financial accounting. Management accounting focuses on internal reporting. It measures and reports financial and nonfinancial information...
-
The price mechanism is least important under _____. a) capitalism b) socialism c) fascism d) communism
-
Wages, rent, interest, and profits flow from ______. a) business firms to households b) households to business firms c) business firms to the government d) the government to business firms.
-
What is commercial paper and how important is it as a source of financing?
-
An advantage of translesion-replicating polymerases is that they can replicate _________________, but a disadvantage is that they _________________. a. very quickly, have low fidelity b. over damaged...
-
In one PCR cycle, the correct order of steps is a. primer annealing, primer extension, denaturation. b. primer annealing, denaturation, primer extension. c. denaturation, primer annealing, primer...
-
If an abnormal repressor protein could still bind allolactose but the binding of allolactose did not alter the conformation of lac repressor, how would the expression of the lac operon be affected?
-
A portion of the coding sequence of a cloned gene is shown here: 5GCCCCCGATCTACATCATTACGGCGAT3 3CGGGGGCTAGATGTAGTAATGCCGCTA5 This portion of the gene encodes a polypeptide with the amino acid...
-
Following the infection of healthy tobacco leaves by reconstituted viruses, what two characteristics did Fraenkel-Conrat and Singer analyze? Explain how their results were consistent with the idea...
-
Seasaw Seasons instituted a defined benefit pension plan for its employees three years ago. Each year since the adoption of the plan, Seasaw has contributed $16,000 to the pension fund, which is...
-
Suppose a population of bacteria doubles every hour, but that 1.0 x 106 individuals are removed before reproduction to be converted into valuable biological by-products. Suppose the population begins...
-
Should we remove all barriers to immigration into the United States? What would be the consequences?
-
If we let in an extra hundred thousand immigrants every year, should we favor certain immigrants over others? Why?
-
What are some of the reasons why the U.S. employer-based healthcare system is relatively inefficient? How does the Affordable Care Act of 2010 seek to address these issues? What makes this...
-
Business Law - United States Principle vs Agent, the concept of representation. What are some past legal cases (atleast 3) and law sections that outline and specify the duty of obedience as an agent?...
-
Calculate the net income per books Checking Account 50,000.00 Fixed Assets 200,000.00 Accumulated Depreciation 15,000.00 Inventory 50,000.00 Note Payable 20,000.00 Capital, Apel 85,000.00 Capital,...
-
TranscribedText: Selected transactions for Ivanhoe Ltd. during its first month of operations are presented below: Mar. 2 Issued commonshares for $11,500 cash. 4 Purchased used car for $1,900 cash and...
Study smarter with the SolutionInn App