Use the key provided below to determine the amino acid sequence of the polypeptide produced from the
Question:
5'TTCTAAACGCATGAAGCACCGTCTCAGAGCCAGTGA3'
3'AAGATTTGCGTACTTCGTGGCAGAGTCTCGGTCACT5'
Direction of DNA unwinding
Transcribed Image Text:
Asn = AAU Cys = TCG Gly = CAG His = CAU Lys = AAG %3D Met = AUG Phe = UUC Ser = AGC Tyr = UAC Val = GUC; GUA %3D %3D 3' Direction of replication fork 5' 3' 5'
Fantastic news! We've Found the answer you've been seeking!
Step by Step Answer:
Answer rating: 80% (15 reviews)
RNA sequence 5 UUC UAC AUG AAG C...View the full answer
Answered By
Ali Khawaja
my expertise are as follows: financial accounting : - journal entries - financial statements including balance sheet, profit & loss account, cash flow statement & statement of changes in equity -consolidated statement of financial position. -ratio analysis -depreciation methods -accounting concepts -understanding and application of all international financial reporting standards (ifrs) -international accounting standards (ias) -etc business analysis : -business strategy -strategic choices -business processes -e-business -e-marketing -project management -finance -hrm financial management : -project appraisal -capital budgeting -net present value (npv) -internal rate of return (irr) -net present value(npv) -payback period -strategic position -strategic choices -information technology -project management -finance -human resource management auditing: -internal audit -external audit -substantive procedures -analytic procedures -designing and assessment of internal controls -developing the flow charts & data flow diagrams -audit reports -engagement letter -materiality economics: -micro -macro -game theory -econometric -mathematical application in economics -empirical macroeconomics -international trade -international political economy -monetary theory and policy -public economics ,business law, and all regarding commerce
4.00+
1+ Reviews
10+ Question Solved
Related Book For
Molecular Cell Biology
ISBN: 978-1429234139
7th edition
Authors: Harvey Lodish, Arnold Berk, Chris A. Kaiser, Monty Krieger, Anthony Bretscher, Hidde Ploegh, Angelika Amon, Matthew P. Scott
Question Posted:
Students also viewed these Life Sciences questions
-
A double-stranded fragment of viral DNA, one of whose strands is shown below, encodes two peptides, called vir-1 and vir-2. Adding this double-stranded DNA fragment to an in vitro transcription and...
-
An mRNA has the following sequence: 5'-AUG UAC UAU GGG GCG UAA-3' Describe the amino acid sequence of the polypeptide that would be encoded by this mRNA. Be specific about the amino-terminus and...
-
Acridine dyes such as proflavin are known to induce primarily single base-pair additions and deletions. Suppose that the wild-type nucleotide sequence in the mRNA produced from a gene is...
-
The following selected financial information was obtained from the 2012 financial reports of Robotranics, Inc. and Technology, Limited: Assume that total assets, total liabilities, and total...
-
Create a response WBS for an event that you would hold on campus. The event can be a dance, a rally, or a dinner. Think large scale like 200 attendees; projects are not small. You can also use a...
-
What are some recent examples of companies that ignored substitute products? This could also include services or other innovations. Discuss your findings and consider why companies have missed...
-
A cylinder having the dimensions shown is made from magnesium Am 1004-T61. If it is struck by a rigid block having a weight of \(800 \mathrm{lb}\) and traveling at \(2 \mathrm{ft} / \mathrm{s}\),...
-
Swedish Navy Company manufactures wristwatches on an assembly line. The work in process inventory as of March 1 consisted of 1,000 watches that were complete as to materials and 75% complete as to...
-
Business success is often tied to effectively managed strategies. Using the Internet, study Starbuck's current performance. Based on analysis, do you judge Starbucks to be a success? Why or why not?...
-
Decide what each partners managerial role in the restaurant will be. For example, who will be responsible for the necessary departments and specific activities? Describe your management hierarchy.
-
You have learned about the events surrounding DNA replication and the central dogma. Identify the steps associated with these processes that will be adversely affected in the following scenarios. a....
-
a. Look at the figure below. Explain why it is necessary for Okazaki fragments to be formed as the lagging strand is produced (instead of a continuous strand). b. If the DNA polymerase in the figure...
-
The equation for the voltage (t) across a capacitor as a function of time is where i(t) is the applied current and Q 0 is the initial charge. Suppose that C = 10 -6 F and that Q 0 = 0. If the applied...
-
Which retail philosophy directly focuses on maintaining long-term bonds with past customers?
-
Sales drives organizational success and without proper motivation sales can suffer.Share your thoughts on ways that companies can motivate and manage their sales staff.
-
The hiring process can be tedious and sometimes brutal. But for a company to have good cohesion it's essential. Although I have no official HR experience, I have run sections and interviewed...
-
Forecasting Denosumab Case Analysis How would you go about forecasting the product in ? Simply describe how you would do it in general. Please describe the assumptions you would use to come up with a...
-
JWD Consulting used the predictive approach to build their intranet site applications. When would the agile approach be a more favorablemethod and what are some advantages of this approach? What...
-
Evaluate the indefinite integral. y(4 y)/ dy
-
Determine whether the lines are parallel, perpendicular, or neither. 2x + 3y = -12, 2y - 3x = 8
-
If you were to slice open a kernel of corn and apply iodine solution to the interior, which part of the kernel do you predict would turn the darkest blue? What is the function of this part of the...
-
Do the embryo and endosperm contain genetic information from the female gamete, the male gamete, or both?
-
After the flu virus is retrieved from the diplomats remains, what is likely to be done with the sample?
-
Schwiesow Corporation has provided the following information: Cost per Cost per Unit Period Direct materials $ 7.05 Direct labor $ 3.50 Variable manufacturing overhead $ 1.65 Fixed manufacturing...
-
Choose an industry in which you are interested in working. How is that industry trending? What internal and external factors may affect the direction of the organization? For your initial post,...
-
The DeVille Company reported pretax accounting Income on its Income statement as follows: 2024 2025 2026 2027 $ 420,000 340,000 410,000 450,000 Included in the income of 2024 was an installment sale...
Study smarter with the SolutionInn App