In Problems 1526, classify each as an example of the commutative property, the associative property, or both.
Question:
In Problems 15–26, classify each as an example of the commutative property, the associative property, or both.
Transcribed Image Text:
6+(2+3)= (2+ 3) + 6
Fantastic news! We've Found the answer you've been seeking!
Step by Step Answer:
Answer rating: 100% (QA)
Answered By
Khurram shahzad
I am an experienced tutor and have more than 7 years’ experience in the field of tutoring. My areas of expertise are Technology, statistics tasks I also tutor in Social Sciences, Humanities, Marketing, Project Management, Geology, Earth Sciences, Life Sciences, Computer Sciences, Physics, Psychology, Law Engineering, Media Studies, IR and many others.
I have been writing blogs, Tech news article, and listicles for American and UK based websites.
4.90+
5+ Reviews
17+ Question Solved
Related Book For
Question Posted:
Students also viewed these Sciences questions
-
In Problems 1526, classify each as an example of the commutative property, the associative property, or both. (Z + S) + (t + c) = (t + 7) + (S + E)
-
In Problems 1526, classify each as an example of the commutative property, the associative property, or both. (s + c) + (+ + 2) = (t + 2) + (S+ )
-
In Problems 1526, classify each as an example of the commutative property, the associative property, or both. (3+5) + (2 + 4) =(3+5) + (4 + 2)
-
Explain the economic basis for the U shape of the long-run average total cost curve.
-
A certain particle is sent into a uniform magnetic field, with the particle's velocity vector perpendicular to the direction of the field. Figure gives the period T of the particle's motion versus...
-
What is the advantage of having a file caching server allow only one client to have a file open for writing at any time?
-
Rainwater flows through the galvanized iron downspout shown in Fig. P8.106 at a rate of \(0.006 \mathrm{~m}^{3} / \mathrm{s}\). Determine the size of the downspout cross section if it is a rectangle...
-
Puffin Industries acquired all of Sunset Coast Digital's stock on December 31,2011, for $3,500,000, $2,100,000 in excess of book value. At that time, Sunset Coast's inventory (LIFO) was overvalued by...
-
Matrix a is given by [ 1 1 - 7 - 6 ] find the inverse
-
In Problems 1526, classify each as an example of the commutative property, the associative property, or both. (9 + 6)(s + +) = (6 + 9)( + +)
-
In Problems 1526, classify each as an example of the commutative property, the associative property, or both. (z + E) + 9 = ( + 7) +9
-
What is the role of equations in this book?
-
An advantage of translesion-replicating polymerases is that they can replicate _________________, but a disadvantage is that they _________________. a. very quickly, have low fidelity b. over damaged...
-
In one PCR cycle, the correct order of steps is a. primer annealing, primer extension, denaturation. b. primer annealing, denaturation, primer extension. c. denaturation, primer annealing, primer...
-
If an abnormal repressor protein could still bind allolactose but the binding of allolactose did not alter the conformation of lac repressor, how would the expression of the lac operon be affected?
-
A portion of the coding sequence of a cloned gene is shown here: 5GCCCCCGATCTACATCATTACGGCGAT3 3CGGGGGCTAGATGTAGTAATGCCGCTA5 This portion of the gene encodes a polypeptide with the amino acid...
-
Following the infection of healthy tobacco leaves by reconstituted viruses, what two characteristics did Fraenkel-Conrat and Singer analyze? Explain how their results were consistent with the idea...
-
Marcus Company assembles products from a group of interconnecting parts. The company produces some of the parts and buys some from outside vendors. The vendor for Part X has just increased its price...
-
To help you become familiar with the accounting standards, this case is designed to take you to the FASBs Web site and have you access various publications. Access the FASBs Web site at...
-
Isomaltose is similar in structure to maltose, except that it is a 16 -glycoside, rather than a 14 -glycoside. Draw the structure of isomaltose.
-
Salicin is a natural analgesic present in the bark of willow trees, and it has been used for thousands of years to treat pain and reduce fevers. (a) Is salicin a reducing sugar? (b) Identify the...
-
Draw a mechanism for the following transformation: . HCI -
-
The sticker price as displayed on a new automobile is $35,450. After a lengthy negotiation, you bought the car for $32685. Determine the percentage reduction off the sticker price that you are...
-
Divide. 2 x +7xy+6y 2x-18y x+4xy-12y 1 x-9y Simplify your answer as much as possible.
-
The price of oil recently went from $13.00 to $18.20 per case of 12 quarts. Find the ratio of the increase in price to the original price. The ratio is (Type a simplified fraction.)
Study smarter with the SolutionInn App