A segment of DNA in E. coli has the following sequence of nucleotide pairs: When this segment
Question:
When this segment of DNA is transcribed by RNA polymerase, what will be the sequence of nucleotides in the RNA transcript?
Transcribed Image Text:
3'-A ACTGTACGTGCTACCTTGCTGATATTACT- TII!!|!||||||||||||||||I|I!|||| 5'-TİGACATGĊAĊGÁTĠGAÁCĠACTATÁÁTGA- GCAATGGGCTGTATCGATGCȚẠCTGCTAT-5' TII|||||||TI|||||||||T||||||| CGTTAČČČGÁČÁŤÁGČŤÁČGÁTGÁČGÁŤÁ-3'
Fantastic news! We've Found the answer you've been seeking!
Step by Step Answer:
Answer rating: 69% (13 reviews)
Given the consensus 35 and 10 sequences in ...View the full answer
Answered By
Asim farooq
I have done MS finance and expertise in the field of Accounting, finance, cost accounting, security analysis and portfolio management and management, MS office is at my fingertips, I want my client to take advantage of my practical knowledge. I have been mentoring my client on a freelancer website from last two years, Currently I am working in Telecom company as a financial analyst and before that working as an accountant with Pepsi for one year. I also join a nonprofit organization as a finance assistant to my job duties are making payment to client after tax calculation, I have started my professional career from teaching I was teaching to a master's level student for two years in the evening.
My Expert Service
Financial accounting, Financial management, Cost accounting, Human resource management, Business communication and report writing. Financial accounting : • Journal entries • Financial statements including balance sheet, Profit & Loss account, Cash flow statement • Adjustment entries • Ratio analysis • Accounting concepts • Single entry accounting • Double entry accounting • Bills of exchange • Bank reconciliation statements Cost accounting : • Budgeting • Job order costing • Process costing • Cost of goods sold Financial management : • Capital budgeting • Net Present Value (NPV) • Internal Rate of Return (IRR) • Payback period • Discounted cash flows • Financial analysis • Capital assets pricing model • Simple interest, Compound interest & annuities
4.40+
65+ Reviews
86+ Question Solved
Related Book For
Principles of Genetics
ISBN: 978-1119142287
7th edition
Authors: D. Peter Snustad, Michael J. Simmons
Question Posted:
Students also viewed these Life Sciences questions
-
A segment of DNA containing 20 base pairs includes 7 guanine residues. How many adenine residues are in the segment? How many uracil residues are in the segment?
-
A segment of DNA has the following sequence: TTGGATGCTGG AACCTACGACC A. What would be the sequence immediately after reaction with nitrous acid? Let the letters H represent hypoxanthine and U...
-
A segment of DNA is put in place and stretched. Figure P7.82 shows a graph of the force exerted on the DNA as a function of the displacement of the stage. Based on this graph, which statement is the...
-
A palindrome is a string that is the same backward as it is forward. For example,tot and otto are rather short palindromes. Write a program that lets a user enter a string and that passes to a bool...
-
In Example 4.21 on page 194, we discussed randomly selecting, without replacement, two students from Professor Weiss's introductory statistics class. Suppose now that three students are selected...
-
Good contracted to build a house for Stern according to Sterns plans. After the house was completed, there were several defects that Good refused to fix. Stern then contracted with Madden to do the...
-
Use invariants to find the optimum lamina orientation for maximizing the shear stiffness \(\bar{Q}_{66}\), then find the corresponding maximum shear stiffness in terms of invariants.
-
Air at a pressure of 1 atm and a temperature of 50C is in parallel flow over the top surface of a flat plate that is heated to a uniform temperature of 100C. The plate has a length of 0.20 m (in the...
-
A 16-year-old girl by the name of Jenny Foster was found hitch-hiking along the Adirondack Mountains Highway in upstate New York. Mr. David Sykes, a driver on the highway, stopped to pick up the...
-
The trial balance for the General Fund of the City of Monte Vista as of December 31, 2012, is presented here: .:. Transactions of the General Fund for the year ended December 31, 2013, are...
-
A segment of DNA in E. coli has the following sequence of nucleotide pairs: When this segment of DNA is transcribed by RNA polymerase, what will be the sequence of nucleotides in the RNA transcript?...
-
A segment of human DNA has the following sequence of nucleotide pairs: When this segment of DNA is transcribed by RNA polymerase, what will be the sequence of nucleotides in the RNA transcript?...
-
Explain why petroleum is currently the primary source of fuel for land and air transport, while coal is the primary fuel for electric power plants.
-
Determine the measure of
-
A solid sphere that is uniformly positively charged produces an electric field. Assume no other objects are around. What is the magnitude of the electric field a distance r from the center of the...
-
Manvir had to make payments of $1,125 every 6 months to settle a $22,000 loan that he received at 4.52% compounded semi-annually. a. How long did it take to settle the loan?
-
Write program Sum.java that just prints the strings that it is given at the command line, one per line. If nothing is given at the command line, print "No arguments". Modify your program (Make a copy...
-
Bank Alpha has given out a pool of mortgages with principal amount of $13 million. These mortgages have an average maturity of 22 years and a monthly mortgage payment of 7 per cent per annum. (Assume...
-
A BMW car dealer in Sicilia, Italy, has the following monthly new car sales data for January through December 2014. The dealer believes that new car sales follow a monthly seasonal pattern and...
-
Describe a group you belong or have belonged discuss the stages of group development and suggest how to improve the group effectiveness by using the group development model.
-
Once cells have differentiated to their final specialized forms, they never again alter expression of their genes. Is the statement true? Explain why or why not.
-
CG islands are thought to have arisen during evolution because they were associated with portions of the genome that remained unmethylated in the germ line. Is the statement true? Explain why or why...
-
In most differentiated tissues, daughter cells retain a memory of gene expression patterns that were present in the parent cell through mechanisms that do not involve changes in the sequence of their...
-
Establishment Industries borrows $1,040 million at an interest rate of 7.2%. It expects to maintain this debt level into the far future. Establishment will pay tax at an effective rate of 38%. What...
-
The Presentation Layer ER Diagram shown in conjunction with part a below is focused around students who participate in sports and also enroll in classes. Please base your answer to this question on...
-
The current price of one share of XYZ stock is 56.50. A long straddle (one long call and one long put) on the stock with a strike price of K and one year to expiration has a total cost of 12.00. The...
Study smarter with the SolutionInn App