AXP Bank has the following assets: loans to an A rated corporation of $200mn, $20mn cash...
Fantastic news! We've Found the answer you've been seeking!
Question:
Transcribed Image Text:
AXP Bank has the following assets: loans to an A rated corporation of $200mn, $20mn cash and $90mn in Australian Treasury bonds. What is the capital amount the bank needs to hold against these exposures assuming minimum CAR of 10.5%? AXP Bank has the following assets: loans to an A rated corporation of $200mn, $20mn cash and $90mn in Australian Treasury bonds. What is the capital amount the bank needs to hold against these exposures assuming minimum CAR of 10.5%?
Expert Answer:
Answer rating: 100% (QA)
calculate the capital amount that AXP Bank needs to hold against its exposures well first determine ... View the full answer
Related Book For
Income Tax Fundamentals 2013
ISBN: 9781285586618
31st Edition
Authors: Gerald E. Whittenburg, Martha Altus Buller, Steven L Gill
Posted Date:
Students also viewed these finance questions
-
Identify the polypeptide encoded by the DNA sequence below, in which the lower strand serves as the template for mRNA synthesis? 5 GGACCTATGATCACCTGCTCCCCGAGTGCTGTTTAGGTGGG 3 3'...
-
The manager for Tyler Bank and Trust has the following assets and liabilities to manage: If the manager wants a duration gap of 3.00, what level of saving accounts should the bank raise? Assume that...
-
Consider an FI with the following off-balance-sheet items: A two-year loan commitment with a face value of $120 million, a standby letter of credit with a face value of $20 million and trade-related...
-
Allison is paid $1,520 per week. What is the amount of federal income tax withheld from Allisons paycheck under the following conditions? Use the percentage method table in the Appendix to this...
-
Suppose that f is continuous on [0, 4], f (0) = 1, and 2 < f(x) < 5 for all x in (0, 4). Show that 9 < f (4) < 21.
-
Consider a regular polygon with 29 sides. The distance from the center to each vertex is a. identical charges q are placed at 28 vertices of the polygon. A single charge Q is placed at the center of...
-
Five tests are performed, and the P-values are 0.02, 0.11, 0.23, 0.38, and 0.45. Use the Bonferroni adjustment to adjust the P-value of 0.02.
-
During a violent thunderstorm with very high wind gusts in the third week of March, the broadcast tower for the public radio station, WVPR, atop Poor Mountain in Roanoke, Virginia, collapsed. This...
-
What is Salvage Value? Can you relate this concept to a non - accounting concept?The book explains the Straight - Line depreciation methods ( page 3 9 6 ) . There are other methods that are important...
-
The Crazy Eddie fraud may appear smaller and gentler than the massive billion-dollar frauds exposed in recent times, such as Bernie Madoffs Ponzi scheme, frauds in the subprime mortgage market, the...
-
Control system of mechanical engineering. values; F1(t)=i(t) f2(t)=x(t) R=0.75 ohm , L= 1L , Kx=9.75[v/m], br=2.4[Ns/m] sx=3[N/m] KLC=1
-
Dexter Industries purchased packaging equipment on January 8 for $187,000. The equipment was expected to have a useful life of four years, or 5,200 operating hours, and a residual value of $15,400....
-
Define the terms emotional intelligence and emotional regulation in your own words. Explain how using emotional intelligence and emotional regulation may increase your own communication effectiveness...
-
Enzo is the founder and co-owner of a new company named EcoChic Handbags, a company that specializes in producing high-quality vegan leather handbags. The company has gained popularity in recent...
-
The following information presents financial results for the two models from last year: Private Label Branded Total Sales revenue Direct material Direct labor Manufacturing overhead Department A-101...
-
Melissa recently paid $625 for round-trip airfare to San Francisco to attend a business conference for three days. Melissa also paid the following expenses: $405 fee to register for the conference,...
-
A 18-year loan requires month-end payments of $627.33 including interest at 9.2% compounded monthly. What is the balance on the loan after half of the payments have been made? (Do not round...
-
Define the essential properties of the following types of operating systems: a. Batch b. Interactive c. Time sharing d. Real time e. Network f. Parallel g. Distributed h. Clustered i. Handheld
-
The following additional information is available for the Dr. Ivan and Irene Incisor family from Chapters 1-4. Ivan and Irene paid the following in 2012 (all by check or can otherwise be...
-
Frederick (Freddy) Freeweights (age 42) owns and operates a health club called ''Treadmills West.'' The business is located at 4321 Arnold Street, Alpine, CA 91901. Freddy had the following income...
-
John Fuji (age 37) moved from California to Washington in December 2011. He lives at 468 Cameo Street, Yakima, WA 98901. John's Social Security number is 571-78-5974 and he is single. His earnings...
-
Explain what the following terms mean a. Accounts receivable f. Accounts payable b. Supplies g. Unearned service revenue c. Prepaid rent h. Service revenue d. Furniture i. Rent expense e. Accumulated...
-
Which columns of the accounting work sheet show unadjusted amounts? a. Trial balance b. Adjustments c. Income Statement d. Balance Sheet
-
Riley Insurance Agency reported the following items at May 31: Make Riley's closing entries, as needed, for these accounts. Sales and marketing expense Other assets Depreciation expense Long-term...
Study smarter with the SolutionInn App