Describe and illustrate how you could differentiate between these four DNA strands, using DNA melting experiments Strand 1 5ATTTTAAATTAGCATTTAAT3 Strand 2 5ATGCCGATATTTTTAGCGCA3 Strand 3 5AGCGGGGCGGCAGCGCGGAT3 Strand 4 5AGCGGGGCGGCAGCGCGGATA3 ...

Normally the DNA strands which have more Guanine and Cytosine are having more melting point G C Con ...

Describe and illustrate how you could differentiate between these four DNA strands, using DNA melting experiments: Strand

Fantastic news! We've Found the answer you've been seeking!

Question:

Describe and illustrate how you could differentiate between these four DNA strands, using DNA melting experiments:

Strand 1: 5ʹATTTTAAATTAGCATTTAAT3ʹ

Strand 2: 5ʹATGCCGATATTTTTAGCGCA3ʹ

Strand 3: 5ʹAGCGGGGCGGCAGCGCGGAT3ʹ

Strand 4: 5ʹAGCGGGGCGGCAGCGCGGATA3ʹ

Related Book For answer-question

Organic Chemistry

ISBN: 978-0981519432

5th edition

Authors: Marc Loudon

See More Books

Posted Date: Apr 12, 2022 03:41 PM

See More Questions

Explain how you could differentiate between the compounds in each of the following pairs by using simple physical or chemical tests that give readily observable results, such as obvious solubility...
What is a Gantt chart Describe and illustrate how a company can effectively incorporate it into its management of its production operation?
Describe and illustrate how an EBDAT (survival) breakeven chart is constructed.
At each point evaluate the function or indicate that the function is undefined there. k(x,y) = xe, (1,0), (3,3), (0, 12)
Tom Hinkerton of Miami, Florida, has decided to set up a high- tech street- corner lemonade stand. He wants to use a notebook computer to record all sales in real time, and he also wants to track his...
What do you think of managers evaluating a promising candidates activity on social media as grounds for rejection, whether or not an interview has even taken place? What might be some ethical issues...
An air standard diesel cycle has a compression ratio of 16. The pressure at the beginning of compression stroke is 1 bar and the temperature is 20C. The maximum temperature is \(1430 C\). Determine...
Hampshire Motors Ltd., a British manufacturing company, wants to buy a production machine that isnt available in England. Comparable products are made by an American company and a French firm. The...
Describe organizational behavior management (OBM) and how it relates to applied behavior analysis (ABA). What is an example of one application of OBM, and what underlying principles of behavior...
Obtain the Target Corporations annual report at http://investors.target.com using the instructions in Appendix B, and use it to answer the following questions: a. What was Targets net income for 2016...
Abc Corp. has made the decision to terminate its long-term, Senior Vice President of Operations, Timothy Jones. According to ABCs President, Sally Reynolds, Tim has been struggling with depression...
Haplotype association studies are aimed at the identification of a particular _________ based on _____________. a. chromosome, an abnormality in its structure b. chromosome, the arrangement of...
Which of the following prenatal genetic testing methods is done in conjunction with in vitro fertilization? a. Amniocentesis b. Chorionic villus sampling c. Preimplantation genetic diagnosis d. All...
Place the following stages of a physical mapping study in their most logical order: A. Clone large fragments of DNA to make a BAC library. B. Determine the DNA sequence of subclones from a cosmid...
In an Ames test, a ____________ number of colonies is observed if a substance ________ a mutagen, compared with the number of colonies for a control sample that is not exposed to the suspected...
What is a haplotype? a. A species with one set of chromosomes b. A cell with one set of chromosomes c. The linkage of alleles or molecular markers on a chromosome d. All of the above describe a...
Find the measure of side b. A 41 b b = (Round the answer to the nearest whole number as needed.) B a = 22 yd C
To balance the chemical equation SiH3 + O2 SiO2 + HO, you could introduce coefficients a, b, c, d and write aSiH3 + bO2 cSiO + dHO then write linear equations for each element. The equation for Si...
Draw the structure of each of the following compounds. (a) m-nitrotoluene (b) 1-bromo.2-propylbenzene (c) Benzyl methyl ether (d) o-cresol
(a) Draw line-and-wedge structures for the two enantiomers of the following allene. (b) One enantiomer of this compound has a specific rotation of - 30.7o. What is the specific rotation of the other?...
Explain why the following equilibrium lies far to the right. CH2 CH toluene (B)
The tube is subjected to a torque of 750 N. m. Determine the amount of this torque that is resisted by the gray shaded section. Solve the problem two ways: (a) by using the torsion formula, (b) by...
The solid shaft has a diameter of 0.75 in. If it is subjected to the torques shown, determine the maximum shear stress developed in regions BC and DE of the shaft. The bearings at A and F allow free...
The solid shaft has a diameter of 0.75 in. If it is subjected to the torques shown, determine the maximum shear stress developed in regions CD and EF of the shaft. The bearings at A and F allow free...

Describe and illustrate how you could differentiate between these four DNA strands, using DNA melting experiments: Strand

Question:

Expert Answer:

Normally the DNA strands which have more Guanine and Cytosine are having more melting point G C Con... View the full answer

Organic Chemistry

Students also viewed these biology questions