Going through the motions... Genotypes to Phenotypes In this activity, you will observe a normal gene...
Fantastic news! We've Found the answer you've been seeking!
Question:
Transcribed Image Text:
Going through the motions... Genotypes to Phenotypes In this activity, you will observe a normal gene and compare it to three (3) mutated sequences. By transcribing and translating each gene sequence, you will determine both where the mutation is located and what type of mutation has occurred. Finally, you will determine how the gene was changed and how it affected the person's phenotype. Procedure: 2) 1) Each student will analyze one of four genes on the back of this sheet: TYR, OCA2, TYRP-1, or SLC45A2. Each student will have a different gene and be responsible for reporting their findings to the other group members. Each form has an original DNA strand and 3 different mutated strands. For each, you will transcribe the mRNA sequence and then translate the mRNA into the amino acid sequence (AAs). 3) With a colored pencil, you will then do the following: • First, circle the mutation(s) on each of the three mutated strands that differ from the original DNA strand at the top of your form. (Note: not all sequences start at beginning of gene.) Second, lightly shade over cach codon that differs in the mRNA strand from the original mRNA strand at the top of your form • Lastly, lightly shade over each amino acid that differs in the amino acid sequence from the original amino acid sequence at the top of your form 4) Using the amino acid sequences, match one of them to the "Individual" cards at your table to view phenotype. Once your analysis is complete, fill out the table below. Analysis: Making sense of your data Your gene: Original DNA Strand Mutation Mutation 1 Mutation 2 Mutation 3 Mutation Type 16-Albinism: From Genotype to Phenotype How did this change occur? Individual # Gene: TYR (OCA1) Cite your evidence here for mutation type Which of the above mutations caused a change in the phenotype? Which mutation did not result in a change in the phenotype? & Name: Gene affected Name: Original DNA Strand Gene: TYR (OCA1) DNA: TACGAGGACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAG mRNA: AAs: Mutation 1 DNA: TACGAGGACCGACAA mRNA: AAs: CATGACGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAGG Mutation 2 DNA: TACGAGGACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTTAAG mRNA: AAs: Mutation 3 DNA: TACGAGAACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAG mRNA: AAs: Going through the motions... Genotypes to Phenotypes In this activity, you will observe a normal gene and compare it to three (3) mutated sequences. By transcribing and translating each gene sequence, you will determine both where the mutation is located and what type of mutation has occurred. Finally, you will determine how the gene was changed and how it affected the person's phenotype. Procedure: 2) 1) Each student will analyze one of four genes on the back of this sheet: TYR, OCA2, TYRP-1, or SLC45A2. Each student will have a different gene and be responsible for reporting their findings to the other group members. Each form has an original DNA strand and 3 different mutated strands. For each, you will transcribe the mRNA sequence and then translate the mRNA into the amino acid sequence (AAs). 3) With a colored pencil, you will then do the following: • First, circle the mutation(s) on each of the three mutated strands that differ from the original DNA strand at the top of your form. (Note: not all sequences start at beginning of gene.) Second, lightly shade over cach codon that differs in the mRNA strand from the original mRNA strand at the top of your form • Lastly, lightly shade over each amino acid that differs in the amino acid sequence from the original amino acid sequence at the top of your form 4) Using the amino acid sequences, match one of them to the "Individual" cards at your table to view phenotype. Once your analysis is complete, fill out the table below. Analysis: Making sense of your data Your gene: Original DNA Strand Mutation Mutation 1 Mutation 2 Mutation 3 Mutation Type 16-Albinism: From Genotype to Phenotype How did this change occur? Individual # Gene: TYR (OCA1) Cite your evidence here for mutation type Which of the above mutations caused a change in the phenotype? Which mutation did not result in a change in the phenotype? & Name: Gene affected Name: Original DNA Strand Gene: TYR (OCA1) DNA: TACGAGGACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAG mRNA: AAs: Mutation 1 DNA: TACGAGGACCGACAA mRNA: AAs: CATGACGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAGG Mutation 2 DNA: TACGAGGACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTTAAG mRNA: AAs: Mutation 3 DNA: TACGAGAACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAG mRNA: AAs:
Expert Answer:
Answer rating: 100% (QA)
Gene TYR OCA1 Mutation 1 Original DNA Strand TACGAGGACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGG... View the full answer
Related Book For
Posted Date:
Students also viewed these accounting questions
-
Determine from the facts below what type of crime has been committed in each situation. 1. Carlos is walking through an amusement park when his wallet, with $2,000 in it, is picked from his pocket....
-
What is meant by turndown ratio? What type of tray has the best turndown ratio? Which tray the worst?
-
What type of letter has parts that are similar to the parts of an internal legal memorandum? How are those parts similar?
-
Evaluate the stiffness matrix for the elements shown in Figure P11-6. Let E = 100 GPa and v = 0.3? Figure P11-6, (a) (b) (25, 25.0) 2 (10, 0, 0) (40, 0,0) (25, 0, 25) (10, 7, 0) (4, 2, 0) (12, 2, 0)...
-
The Wallace Stationary Company purchases paper from the Seaboard Paper Company. Wallace produces stationary that require 1,415,000 sq. yards of stationary per year. The cost per order for the company...
-
We are examining a new project. We expect to sell 6,500 units per year at $43 net cash flow apiece for the next 10 years. In other words, the annual operating cash flow is projected to be $43 6,500...
-
Find a case in California that discusses the hearsay exception. What did the court rule?
-
A stream of pure cyclopentane vapor flowing at a rate of 1550 L/s at 150C and 1 atm enters a cooler in which 55% of the feed is condensed at constant pressure. (a) What is the temperature at the...
-
Find and review the Twitter accounts of three reporters: One from a national news organization (CNN, New York Times, Washington Post, etc.) One from a regional/local news organization (Centre Daily...
-
Determine the maximum load that can be allowed on the 450 mm diameter pile shown in Figure P12.9, with a factor of safety of 3. Use the a method and Table 12.11 for determining the skin friction and...
-
Choose any three stages from Knapp's relational stages model (either coming together are coming apart). Choose either a fictional relationship (e.g. Jim and Paul, Aladdin and Jasmine etc.) OR use one...
-
Swiss Chocolates Ltd produces blocks of chocolate. Raw materials in the form of cocoa solids, milk and sugar are added at the beginning of the process, flavouring, fruit and nuts are added half-way...
-
Information from the records of Manufacturing Systems Pty Ltd for the year ended 30 June 2019 is given below. Required (a) Calculate the ending work in process inventory on 30 June 2019. Factory...
-
Listed below are selected financial data from the accounting records of Innovative Computers Pty Ltd for the year ended 30 June 2019. Required (a) Prepare an income statement for the year ended 30...
-
For each company below, fill in the missing data. Each company is independent. Sales Beginning finished goods Cost of goods manufactured Ending finished goods Cost of sales Income Statement Company X...
-
Go to the Securities and Exchange Commissions A Plain English Handbook at http://www.sec.gov/pdf/handbook.pdf. Scroll down to Appendix B and look at the four before and after examples. What kinds of...
-
After a brand failure, the most important task is to gather all the facts Question 6 6 Answer True False
-
2.) Find the Laplace transform of f(t) 7e-St cos 2t +9 sinh2 2t. Use Laplace Table. %3D
-
The Heese Restaurant Group supplies its franchise restaurants with many pre- manufactured ingredients (such as bags of frozen French fries), while other ingredients (such as lettuce and tomatoes) are...
-
One subunit of Pacific Sports Manufacturing Company had the following financial results last month: Requirements 1. Complete the performance evaluation report for this subunit (round to four...
-
Verifine Optical Company reported the following amounts on its balance sheet atDecember 31: Cash and receivables.................................................................................... $...
-
What is evidence and why is it important to internal auditors?
-
Why is hearsay evidence suspect?
-
In making appraisals, how should internal auditors view the results of their tests?
Study smarter with the SolutionInn App