If you were verifying the cloning of the gene that contains the vector, which of the...
Fantastic news! We've Found the answer you've been seeking!
Question:
Transcribed Image Text:
If you were verifying the cloning of the gene that contains the vector, which of the three amplifications would be your best test and why? Primer Sequence (5'-3) Product (pb) M13F_pUC AGCGGATAACAATTTCACACAGG M13R_pUC CCCAGTCACGACGTTGTAAAACG 2604 2 TagF GGGATGCTGCCCCTCTTTGAGCCC TaqR TCACTCCTTGGCGGAGAGCCAGTCC 2492 AmpF ATGAGTATTCAACATTTCCGTGTCG AmpR TTACCAATGCTTAATCAGTGAGGC 860 2500 2.750 2000 Taq polymerase * JaqR (3604) M13R pUC (3676) TagF (1112) M13F pUC (1072)- PAK Taq. 7,043 bp lati AmpR (3873) AmpR siso doo Ampf (6013) cog's ost 3. If you were verifying the cloning of the gene that contains the vector, which of the three amplifications would be your best test and why? Primer Sequence (5'-3) Product (pb) M13F_pUC AGCGGATAACAATTTCACACAGG M13R_pUC CCCAGTCACGACGTTGTAAAACG 2604 2 TagF GGGATGCTGCCCCTCTTTGAGCCC TaqR TCACTCCTTGGCGGAGAGCCAGTCC 2492 AmpF ATGAGTATTCAACATTTCCGTGTCG AmpR TTACCAATGCTTAATCAGTGAGGC 860 2500 2.750 2000 Taq polymerase * JaqR (3604) M13R pUC (3676) TagF (1112) M13F pUC (1072)- PAK Taq. 7,043 bp lati AmpR (3873) AmpR siso doo Ampf (6013) cog's ost 3.
Expert Answer:
Answer rating: 100% (QA)
taq primer amplifier sequence is best to verifying the cloning of the gene that contains the vector Reason Taq polymerase denotes the heatstable DNA p... View the full answer
Posted Date:
Students also viewed these biology questions
-
Why is a thermostable form of DNA polymerase (e.g., Taq polymerase) used in PCR? Is it necessary to use a thermostable form of DNA polymerase in the techniques of dideoxy DNA sequencing or...
-
If a gene contains three introns, draw what it would look like in an R loop experiment.
-
The gene encoding the beta subunit of RNA polymerase from Escherichia coli is said to be orthologous to the rpoB gene of Bacillus subtilis. What does that mean about the relationship between the two...
-
According to a study conducted by the Gallup organization, the proportion of Americans who are afraid to y is 0.10. A random sample of 1100 Americans results in 121 indicating that they are afraid to...
-
What is a statement of cash flows?
-
Shalit Corporations 2008 sales were $12 million. Its 2003 sales were $6 million. a. At what rate have sales been growing? b. Suppose someone made this statement: Sales doubled in 5 years. This...
-
(a) In Figure 10.2, what is the ball's velocity the instant before it is released? (b) Is the ball's speed in the reference frame of the cart greater than, equal to, or smaller than its speed in the...
-
Shastri Bicycle of Bombay, India, produces an inexpensive, yet rugged, bicycle for use on the citys crowded streets that it sells for 500 rupees. (Indian currency is denominated in rupees, denoted by...
-
The Power of Trade and Comparative Advantage: Work It Out 3 ? Here's another specialization and exchange problem. This problem is wholly made-up, ? so that you won't be able to use your intuition...
-
You serve as the trustee for the Josephine Frederick testamentary income trust. The trust was created by the will of her late husband, John. Under the terms of John's will, all assets are transferred...
-
The current earnings of Video Inc. are $2.00 a share, and it has just paid an annual dividend of 40 cents. You forecast that for the next four years both earnings and dividends of the company will...
-
What is the difference between an absolute and qualified privilege? a. Who enjoys an absolute privilege? b. Under what circumstances is a defendant protected by a qualified privilege? c. How can a...
-
True Or False Under contemporary court decisions, presumed damages can never be awarded unless the plaintiff can prove actual malice.
-
True Or False A defamation plaintiff must prove that the defendants statement is defamatory in accord with at least one interpretation a reasonable person might make.
-
Why was defamation considered a strict liability tort under the common law? a. How did New York Times v. Sullivan change that situation? b. What is the definition of actual malice, and when must it...
-
How did New York Times v. Sullivan change the face of defamation?
-
Sometimes managers get so caught up doing the work of their employees that they? Get trapped into doing work they dislike Neglect their own responsibilities and become less effective managers End up...
-
If a process has a six-sigma capability, what is the process capability index? a. 1 b. 2 c. 6 d. 12
-
Consider the following binary linear programming formulation of a capital budgeting problem. \[ \begin{array}{ll} \text { Max } & 1,200 x_{1}+600 x_{2}+950 x_{3}+1,650 x_{4} \\ \text { s.t. } &...
-
A proton with an initial speed of \(800,000 \mathrm{~m} / \mathrm{s}\) is brought to rest by an electric field. a. Did the proton move into a region of higher potential or lower potential? b. What...
-
A 1.0-cm-diameter sphere is charged to a potential of \(3400 \mathrm{~V}\). How much charge is on the sphere?
Study smarter with the SolutionInn App