In the longest palindrom substring (or longest sysmmetric factor), the goal is to find the maximum-length...

Transcribed Image Text:

In the longest palindrom substring (or longest sysmmetric factor), the goal is to find the maximum-length contiguous substring in a given text which is also a palindrome. A palin- dromic word refers to a ward or a phrase that reads the same in both directions, i.e, when it is read in forward and reverse directions. Examples of palindromes are strings "civic", "racecar", and "aibohphobia". Consider the following DNA sequence: "AGCTTTTCCCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGGTTCTGAACTGGTT ACCTGCCGTGAGTAAATTAAAATATTATTGACTTAGGTCACTAAATACTTTAACCAATATAGGCATAGCGCAGACAGATAAAAA" • Explain how to use a code for LCS to find the longest palindrome of any sequence. • Provide the code that implements your solution. This code should use your previous LCS code as a function. If we consider the above DNA sequence as a text sequence, report the output of your palindrome code applied on this sequence (provide both the palindrome substring and its length). In the longest palindrom substring (or longest sysmmetric factor), the goal is to find the maximum-length contiguous substring in a given text which is also a palindrome. A palin- dromic word refers to a ward or a phrase that reads the same in both directions, i.e, when it is read in forward and reverse directions. Examples of palindromes are strings "civic", "racecar", and "aibohphobia". Consider the following DNA sequence: "AGCTTTTCCCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGGTTCTGAACTGGTT ACCTGCCGTGAGTAAATTAAAATATTATTGACTTAGGTCACTAAATACTTTAACCAATATAGGCATAGCGCAGACAGATAAAAA" • Explain how to use a code for LCS to find the longest palindrome of any sequence. • Provide the code that implements your solution. This code should use your previous LCS code as a function. If we consider the above DNA sequence as a text sequence, report the output of your palindrome code applied on this sequence (provide both the palindrome substring and its length).

Answer rating: 100% (QA)

To find the longest palindrome substring of a given sequence you can adapt the Longest Common Subseq... View the full answer