TGAATTCCCGGGTTCCGGGAATTCGCGCGAATTCCCGGTATA, what is its complementary strand A) For this DNA fragment (from 5' to 3') (1...
Fantastic news! We've Found the answer you've been seeking!
Question:
Transcribed Image Text:
"TGAATTCCCGGGTTCCGGGAATTCGCGCGAATTCCCGGTATA", what is its complementary strand A) For this DNA fragment (from 5' to 3') (1 mark)? B) What are the products when the DNA with the above sequence is incubated with the restriction enzyme EcoRI (0.5 marks)? C) What are the products when the DNA with the above sequence is incubated with the restriction enzyme Mspl (0.5 marks)? D) Draw the first two (2) base pairings of the DNA molecule from the 5' end and label all key elements of the molecule including the bonds involved (2 marks). "TGAATTCCCGGGTTCCGGGAATTCGCGCGAATTCCCGGTATA", what is its complementary strand A) For this DNA fragment (from 5' to 3') (1 mark)? B) What are the products when the DNA with the above sequence is incubated with the restriction enzyme EcoRI (0.5 marks)? C) What are the products when the DNA with the above sequence is incubated with the restriction enzyme Mspl (0.5 marks)? D) Draw the first two (2) base pairings of the DNA molecule from the 5' end and label all key elements of the molecule including the bonds involved (2 marks).
Expert Answer:
Answer rating: 100% (QA)
A Complementary strand for the give DNA sequence is 5 TGAATTCCCGGGTTCCGGGAATTCGCGCGAATTCCCGGTATA 3 G... View the full answer
Related Book For
Microbiology A Human Perspective
ISBN: 978-0073375311
7th edition
Authors: Eugene Nester, Denise Anderson, Evans Roberts
Posted Date:
Students also viewed these chemistry questions
-
A small DNA molecule was cleaved with several dierent restriction nucleases, and the size of each fragment was determined by gel electrophoresis. The following data were obtained. Enzyme Fragment...
-
The recognition sequence for the restriction enzyme TaqI is TTCGA. Indicate the products of the reaction of TaqI with the DNA sequence shown. 5'-ACGTCGAATC-3' 3'-TGCAGCTTAG-5'
-
Mark Lawrencethe man with two first nameshas been pursuing a vision for more than two years. This pursuit began when he became frustrated in his role as director of human resources at Cutting Edge, a...
-
Suppose that 1 8 E1 1 E2 1 4 and E, E A = I. Express A as a product of elementary matrices. 1 1 -8 8 () A 1 -8 (A) A (C) A = 4 1 -4 -4 1 1 (D) A = 1 1 1 1 -8 1 1 1 -8 (E) A = 4 (F) A (G) A 4 4 1 1 1...
-
Friendleys Miniature Golf and Driving Range Inc. was opened on March 1 by Dean Barley. These selected events and transactions occurred during March. Mar. 1 Stockholders invested $50,000 cash in the...
-
An urn contains r red balls and w white balls. A sample of n balls is drawn in order and without replacement. Let Xi be 1 if the ith draw is red and 0 otherwise, i =1, 2, . . . , n. (a) Show that...
-
Steven Myer and William Riggs are partners in an existing business. Each partner has equity of \($30,000.00.\) On October 1 of the current year, the two partners agree to admit Sandra DeVito as a...
-
Kate Drew has been hand-painting wooden Christmas ornaments for several years. Recently, she has hired some friends to help her increase the volume of her business. In checking the quality of the...
-
1. Payback Jones Company is considering investing in a new piece of equipment that costs $600,000. The new equipment should provide cost savings of $150,000 per year over its 5-year useful life. What...
-
The financial statements of Aritzia Inc. are presented in Appendix A at the end of this textbook. Instructions a. What title does Aritzia use for its income statement? What title does Aritzia use for...
-
Write the various methods in Map interface. List the characteristics of Big Data.
-
Solve. Assume all variables are positive. P T = -1, for R R R =
-
Interpret the results of the FMS test results. Are there any similarities between theresults?Whatis youroverallanalysis? Chooseandexplainthemostappropriate resistanceexercise...
-
Load distribution of a wing with finite span. If the load distribution on a finite-span wing is as shown, sketch the trailing vortex system, indicating the magnitude and direction of the trailing...
-
Baskin Company's net income last year was $98,000. Changes in the company's balance sheet accounts for the year appear below: Increases (Decreases) Debit balances: Cash $24,000 Accounts receivable...
-
Consider a plane wave incident from medium#1 having a refractive index n=1.33 to air (medium# 2). The angle of incidence is . The incident electric field is polarized along the y-direction. The...
-
16. Solve the following triangles using SOHCAHTOA and Pythagoras. Show all work. a. In the figure below, the 4.0 meter ladder makes a 60. degree angle with the ground. y 4.0 m 600 i. How high does...
-
The following information is available for Partin Company: Sales $598,000 Sales Returns and Allowances 20,000 Cost of Goods Sold 398,000 Selling Expense 69,000 Administrative Expense 25,000 Interest...
-
Describe the difference between the terms antibiotic and antimicrobial.
-
Describe two ways to decrease the chance of contracting a cold.
-
Why is water a polar molecule? Give two examples of why this property is important in microbiology.
-
Many retailers have installed point-of-sale (POS) systems to better manage their inventory and to save time and cut costs associated with ringing up customer sales. How should employees be trained to...
-
Airlines have long used database technology to monitor capacity and maximize revenue by charging different prices to almost every passenger on a given flight. To what extent can other industries...
-
Why not use copies of the sales order as the picking ticket, packing list, and sales invoice?
Study smarter with the SolutionInn App