The DNA sequence shown is found in the middle of a gene. If this is the...

 

Transcribed Image Text:

The DNA sequence shown is found in the middle of a gene. If this is the coding strand, which reading frame(s) is the most likely to be the one used for this gene? and what are the first three amino acids encoded by this frame? Hint: for the sequence 5'-GATTACA, frame +1 is GAT-TAC-..., +2 is ..G-ATT-ACA... For -1 you take the complementary strand and do the same. O both +1 and +2 O +3, Leu Thr Gln O +2, Ala Val Thr both +1 and +3 O+1, Gly Cys Asp 5 GGCTGTGACAATCTAGTCAAAA The DNA sequence shown is found in the middle of a gene. If this is the coding strand, which reading frame(s) is the most likely to be the one used for this gene? and what are the first three amino acids encoded by this frame? Hint: for the sequence 5'-GATTACA, frame +1 is GAT-TAC-..., +2 is ..G-ATT-ACA... For -1 you take the complementary strand and do the same. O both +1 and +2 O +3, Leu Thr Gln O +2, Ala Val Thr both +1 and +3 O+1, Gly Cys Asp 5 GGCTGTGACAATCTAGTCAAAA

Answer rating: 100% (QA)

The detailed answer for the above question is provided below To determine ... View the full answer