The figure below shows the recognition sequences and cleavage positions of three restriction enzymes. BamHI Bg/II...
Fantastic news! We've Found the answer you've been seeking!
Question:
Transcribed Image Text:
The figure below shows the recognition sequences and cleavage positions of three restriction enzymes. BamHI Bg/II NdeIl 5'- GGATCC - 3' 3'- CCTAGG - 5' 5'- AGATCT - 3" 3'- ТСТАGA -5' 5- GATC - 3 3- CTAG - 3' You plan to ligate DNA from two different sources. The target DNA is digested with BamHI, and the insert DNA is digested with Bg/II, and the resulting fragments mixed and incubated with DNA ligase. Target DNA: Insert DNA: 5 .....ACCAGTAGGATCCGATGCGT... 5 CGTAGATCTACCGTACGTGCTACGAGATCTGGC 3' .TGGTCATCCTAGGCTACGCA... 31 GCATCTAGATGGCATGCACGATGCTCTAGACCG a) What type of overhang is generated by these three enzymes? b) Write out the sequence (in double-stranded format) of the longest insert fragment that will results after BglII digestion, ensure the nature of the overhangs is clear. 1 c) What is the function of the DNA ligase enzyme? Write out the sequence (in double-stranded format) of the ligation product, with the insert fragment joined into the BamHI site of the target DNA. Use black for target sequences, and blue for insert sequences. Assume the ligation reaction was successful and you have generated a recombinant DNA e) molecule. Which of the three enzymes listed above can be used to excise the insert DNA from the target? Motivate your answer. The figure below shows the recognition sequences and cleavage positions of three restriction enzymes. BamHI Bg/II NdeIl 5'- GGATCC - 3' 3'- CCTAGG - 5' 5'- AGATCT - 3" 3'- ТСТАGA -5' 5- GATC - 3 3- CTAG - 3' You plan to ligate DNA from two different sources. The target DNA is digested with BamHI, and the insert DNA is digested with Bg/II, and the resulting fragments mixed and incubated with DNA ligase. Target DNA: Insert DNA: 5 .....ACCAGTAGGATCCGATGCGT... 5 CGTAGATCTACCGTACGTGCTACGAGATCTGGC 3' .TGGTCATCCTAGGCTACGCA... 31 GCATCTAGATGGCATGCACGATGCTCTAGACCG a) What type of overhang is generated by these three enzymes? b) Write out the sequence (in double-stranded format) of the longest insert fragment that will results after BglII digestion, ensure the nature of the overhangs is clear. 1 c) What is the function of the DNA ligase enzyme? Write out the sequence (in double-stranded format) of the ligation product, with the insert fragment joined into the BamHI site of the target DNA. Use black for target sequences, and blue for insert sequences. Assume the ligation reaction was successful and you have generated a recombinant DNA e) molecule. Which of the three enzymes listed above can be used to excise the insert DNA from the target? Motivate your answer.
Expert Answer:
Answer rating: 100% (QA)
3 a The type of overhang generated from the above restriction enzymes will be of the staggered type ... View the full answer
Related Book For
Posted Date:
Students also viewed these biology questions
-
The figure below shows the production possibilities frontiers (PPFs) for Italy and India for their domestic production of olives and tea. Without trade, assume that each is consuming olives and tea...
-
The figure below shows the one-year return distribution for RCS stock. Calculate a. The expected return. b. The standard deviation of thereturn. 35 30 25 20 15F 2 10 -25% -10% 0% 10% 25% Return
-
The figure below shows a scheme for testing hydrocarbon compounds to determine whether they are saturated or unsaturated. Draw the scheme and complete it by filling in the missing words related to...
-
What are the concepts of traditional and contemporary organizational design? Will these designs be influenced differently by management and the environment?
-
Taylor Chemicals produces a particular chemical at a fixed cost of $ 1,000 per day. The following table displays how marginal cost varies with output (in cases): Quantity (Cases) Marginal Cost 1.. $...
-
What are the retail banking liabilities product based on Maslow theory of needs hierarchy?
-
Compare and contrast the differences between compliance, substantive and weakness testing.
-
National Investor Group is opening an office in Portland. Fixed monthly costs are office rent ($8,500), depreciation on office furniture ($2,000), utilities ($2,100), special telephone lines...
-
Mario and Peach are racing along Rainbow Road each with an initial velocity of 19 m/s.The two of them are level until Peach hits a speed boost and experiences an acceleration of 2 m/s 2 for 2 s....
-
Valerie Fons operates a retail clothing operation. She purchases all merchandise inventory on credit and uses a periodic inventory system. The Accounts Payable account is used for recording inventory...
-
On January 1, Patterson Corporation acquired 80 percent of the 100,000 outstanding voting shares of Soriano, Inc., in exchange for $31.25 per share cash. The remaining 20 percent of Sorianos shares...
-
A company is planning to purchase a machine to meet the increased demand for its products in the market. The machine costs 50,000 and has no salvage value. The expected life of the machine is 5...
-
Falco Oil Company began operations in 2017. During that year, Falco drilled an exploratory well on a lease located in a remote area where any oil discovered would need to be transported via a...
-
McGavin Oil Company obtained 200 Mcf of gas from Lease A and used the gas for gas injection on Lease B. The gas was valued at $12/Mcf. Assume production taxes are 5% and the royalty on Lease A is a...
-
In October 2019, Frakel Corporation drilled an exploratory well that found oil. However, the quantity of oil discovered was not commercially producible unless the price of oil went up from the...
-
Allen Petroleum drilled an exploratory well in 2018 that was still in progress at year-end. Total costs incurred by 12/31/18 were $500,000. During January 2019, drilling was continued, and additional...
-
What is the maximum mass that can hang without sinking from a 50.0-cm-diameter Styrofoam sphere in water? Assume the volume of the mass is negligible compared to that of the sphere. units
-
Wal-Mart is the second largest retailer in the world. The data file on the disk holds monthly data on Wal-Marts revenue, along with several possibly related economic variables. a) Using computer...
-
The Economist commented on the Greek debt crisis in an aptly titled article on February 11, 2012, Brinkmanship in Athens, as Greece led the European economy to the edge as a battle brewed between...
-
The following figure shows the supply and demand for strawberries. Answer the questions that follow. Supply and Demand of Strawberries a. Indicate the equilibrium price and equilibrium quantity. b....
-
How do sticky wages and prices make monetary policy effective in the short run?
-
The central difference approximation of \(d^{4} W / d x^{4}-\beta^{4} W=0\) at grid point \(i\) with step size \(h\) is a. \(W_{i+2}-4 W_{i+1}+\left(6-h^{4} \beta^{4} ight) W_{i}-4...
-
What is the difference between explicit and implicit integration methods?
-
Find the solution of a spring-mass-damper system governed by the equation \(m \ddot{x}+c \dot{x}+k x=F(t)=\delta F . t\) with \(m=c=k=1\) and \(\delta F=1\). Assume the initial values of \(x\) and...
Study smarter with the SolutionInn App