The information listed below summanizes the current state of our knowledge concerning Syndrome X. All of...
Fantastic news! We've Found the answer you've been seeking!
Question:
Transcribed Image Text:
The information listed below summanizes the current state of our knowledge concerning Syndrome X. All of the data presented are real. The actual name of the syndrome has been fabricated so as not to deprive our students of the intellctual joy derived from utilizing the data to formulate responses to the questions that follow the summary given below. a) Syndrome X is a human genetic disorder that results from a defeet at one genetic locus and patients with the disorder manifest pleiotropic effects that occur during embryonic development. These effects include malformation of the anterior of the eye (which causes the eye discase known as glaucoma in 50% of Syndrome X patients), mikd head and face malformations and underdeveloped teeth. One of the pedigrees used to determine the mode of inheritance of the disorder is found below. b) Familics displaying the discase were examined for linkage of the discase locus to a polymorphic site unique to cach family. From such studics scientists were able to report linkage of the gene that is defective in the disorder to chromosome 4. (From this point on we will use the term "gene s" to designare the normal form of the gene that is defective in Syndrome X.) c) Investigators used positional cloning strategies, a methodology for isolating a cDNA clone coding for a gene when one knows nothing about the function of the protein encoded by the gene and has no probe for use in screening a cDNA library, and ultimately isolated a full length cDNA clone coding for the normal gene x. Subscquently, they isolated a human genomic clonc coding for gene x. d) The cDNA clone as well as parts of the genomic clone were sequenced. The results are shown in Fig. 1. e) since nothing was known about the structure or function of the protein encoded by gene x, scientists deduced its amino acid sequence from the cDNA nucleotide sequence of gene x and used it for further studies. The deduced amino acid sequence was analyzed via software capable of predicting with some degree of accuracy, the secondary structure of a protein ( but not the complete tertiary structure) and the presence of a helix-turn-helix was revealed. ) Mutant gene x isolated from members of 10 different families diagnosed with Syndrome X were analyzed to identify the mutations therein. One family showed the following mutation. Nuckotide number 981 was changed from a G to an A as shown in Fig.i. The other nine families showed other distinet mutations. 8) It is often helpful when studying human genetic disorders to have a mouse model of the discase as well as a mouse eDNA clone for the gene under study. F'or this reason, scientists isolated a mouse el)NA clone whose deduced amino acid sequence showed a 91% similarity to the deduced amino acid sequence for human gene Uslizing all of the data presented, in conjunction with the many concepts that you have learned this semester, answer the questions that follow. 3. (15 pts) How large is the cDNA? How many amino acids make up protein x? Predict an approximate molecular weight of protein X in Daltons (use 100 as average molecular weight of an amino acid). 4. (10 prs) How did the mutation at nucleotide 981 change the secquence of protein x? This mutation obviously had a detrimental effect on the function of the protein x. Provide an explanation for this dekterious effecet. 5. (25) You have been tokd that scientists isolated a mouse eDNA that encoded a protcin similar to that encoded by the human gene x. Assume it is your task to isolate the normal mouse eDNA for gene x. Design an experiment to do this. If you choose to screen a library, make sure to indicate 1) from what mouse tissue you would isolate the mRNA for your cDNA ibrary construction 2) what probe you would use to screen the library. Be brief and to the point. 6. (25) Assume you are a genetic counselor and the family with the G to A base change (already has one child effected with Syndrome X) is expecting a child and inquires if a prenatal diagnosis could be done to determine if this chikl were affected. The clones, general knowkdge concerning the mutation in this family and current state of the art of biotechnology, design a prenatal test for this family. Be brief and to the point. Pedigree of A Syndrome X Famly 1004 GOCTcceTATCCACCARSAGCTreecerTCTTCAASTCTATGAAC Alaserleuser ThelyaderPhePeePhePheAanserNetAee 155 101 151 201 251 201 351 1049 GTCAACCccerorCATCACAGAGCATGTTTICcCCMcCCAACICT ValkantroleuserserGinsacMetPhesertrotrokanser 170 CAGC GAS 1094 ATCtcorcCAZGAGCATGrCorocAGCATGGrGcccrCAGCAGTG ieserserMetserMetsersersetMetvaltrederalaval 185 451 501 GAGO AGO 1139 ACAGOCrcecocccreCACTCTCAACAGCCIGAATAACTIGAAC Met GiuThrAsscya cCCAAACTOGTGTccacerarerSCAATTAGgtaagaaccecet AretyalevalderAlacyavaiGinies 15 114 AACCrGAGTAGCceGreae TGAATTCescsorscCGAcaccrsce Aanieuserder7roferteukanserAlavaltrothrtrokle 235 teteetg tgtgtttcegtttcagAGAARGATAAAAGE ClulysAsplysser 20 1229 TGTCCTTACGEGccsccGACTCCrecOTATOTATAGGGACACG CyatretyralaProProthedretrotyrvaityrargaspThr 230 CAGCAGGGGAAGRATGAGGACGTOsacGcCGAGGACCCorCTAAG CiEcinciyiyaksnGiukapvaliyAaGluaapproserLys 44 1274 TOEAACTCGAGCCroscCAGcTGAGACTGAAAGCAAAGCAGCAC CysAserserteAiaserleuaretealyaAleiysolatis 245 35 AAGAAGCOOCAAAG CACTETACSARCCAOCAG 50 1319 TCCAGCTIcoactAcocCAocoICCAGAAALCOGCCrCCAACCIG Serser PheblytyrAlafervalGIalyatroAlaserEAleu 260 734 SICCACCARCTOCAPGCCACECCAGAGGAACCOCTAcccOGAC 65 1364 AGTGCIoCCAGIATOCACIcACCGacccaTeTA, GCCOCACCCAC SecAlacysGintyEAiavalAspargrovaistop 271 TGAAA 1411 AGCGCCGGGAT 1461 GACTGGGAATTATO 1511 1561 1611 ATGTCCACACGCGAAGAAATCGCTOTG GACCAACCTTACOGAA AGAGAAA AGCTOCT 79 ACTGAATC GAGAAGCTATATA TGATTCA CACATT AACAT TATA 1711 1761 1011 1861 1911 1961 GT 2011 ATAACA 2041 AATGTG 2111 AAAAM SESSGAGTECStgapccagescggagtet cecttgecce AlaargvalArg 24 GAGCAA aacegeccocagEGGTICAAGAATCSICGGGECAAATGSAGA MAAAAAA AAGAGGGASCGCAACCAGCAGSCCGAGCTATGCAAGAATGGCTTC 110 Fig I Nucleotide and deduced amino acid sequence of the human gene x. In sequence (shown in lower case) was determined only at intron-exon junctio 125 The start (ATG) and stop (TGA) codons are in boldface, as are the conser gt and ag sequences flanking each intron and the polyadenylation signals in 140 untranslated region Multiple stop codons S from the initiation methionine a underlined GGGCcGCASITCAATGoacICATGCAGCeCTACGACGACATOTAC GlyPreGiaPheasnciyleuhetGlaProtyrAspaspnetTyr 914 CCAGGCTATICCTACAACAACtcoceoCCAAGGGCCTTACATCe PreGlytyrsertyrAnnAantepaianlalysGlyleutarSer 159 Question 1 The information listed below summarizes the current state of our knowledge concerning Syndrome X All of the data presented are real. The actual name of the syndrome has been fäbricated so as not to deprive our students of the intellectual joy derived from utilizing the data to formulate responses to the questions that follow the summary given below. D Syndrome X is a human genetic disorder that results from a defect at one genetic locus and parients with the disorder manifest pleiotropic effects that occur during embryonie development. These effects include malformation of the anterior of the cye (which causes the eye disease known as glaucoma in 50%% of Syndrome X patients), mild head and face malformations and underdeveloped teeth. One of the pedigrees used to determine the mode of inheritance of the disorder is found below. b) Families displaying the disease were examined for linkage of the disease locus to a polymorphic site unique to each family. From such studies scientists were able to report linkage of the gene that is defecuve in the disorder to chromosome 4. (From this point on we will use the term "gene x" to designate the normal form of the gene that is defective in Syndrome X.) ) Investigators used positional cloning strategies, a methodology for isolating a cDNA clone coding for a gene when one knows nothing about the function of the protein encoded by the gene and has no probe for use in screening a CDNA library, and ultimately isolated a full length CDNA clone coding for the nomal gene x. Subsequently, they isolated a human genomic clone coding for gene x. Pedigree of A Syndrome X Fa mily 28 The information listed below summanizes the current state of our knowledge concerning Syndrome X. All of the data presented are real. The actual name of the syndrome has been fabricated so as not to deprive our students of the intellctual joy derived from utilizing the data to formulate responses to the questions that follow the summary given below. a) Syndrome X is a human genetic disorder that results from a defeet at one genetic locus and patients with the disorder manifest pleiotropic effects that occur during embryonic development. These effects include malformation of the anterior of the eye (which causes the eye discase known as glaucoma in 50% of Syndrome X patients), mikd head and face malformations and underdeveloped teeth. One of the pedigrees used to determine the mode of inheritance of the disorder is found below. b) Familics displaying the discase were examined for linkage of the discase locus to a polymorphic site unique to cach family. From such studics scientists were able to report linkage of the gene that is defective in the disorder to chromosome 4. (From this point on we will use the term "gene s" to designare the normal form of the gene that is defective in Syndrome X.) c) Investigators used positional cloning strategies, a methodology for isolating a cDNA clone coding for a gene when one knows nothing about the function of the protein encoded by the gene and has no probe for use in screening a cDNA library, and ultimately isolated a full length cDNA clone coding for the normal gene x. Subscquently, they isolated a human genomic clonc coding for gene x. d) The cDNA clone as well as parts of the genomic clone were sequenced. The results are shown in Fig. 1. e) since nothing was known about the structure or function of the protein encoded by gene x, scientists deduced its amino acid sequence from the cDNA nucleotide sequence of gene x and used it for further studies. The deduced amino acid sequence was analyzed via software capable of predicting with some degree of accuracy, the secondary structure of a protein ( but not the complete tertiary structure) and the presence of a helix-turn-helix was revealed. ) Mutant gene x isolated from members of 10 different families diagnosed with Syndrome X were analyzed to identify the mutations therein. One family showed the following mutation. Nuckotide number 981 was changed from a G to an A as shown in Fig.i. The other nine families showed other distinet mutations. 8) It is often helpful when studying human genetic disorders to have a mouse model of the discase as well as a mouse eDNA clone for the gene under study. F'or this reason, scientists isolated a mouse el)NA clone whose deduced amino acid sequence showed a 91% similarity to the deduced amino acid sequence for human gene Uslizing all of the data presented, in conjunction with the many concepts that you have learned this semester, answer the questions that follow. 3. (15 pts) How large is the cDNA? How many amino acids make up protein x? Predict an approximate molecular weight of protein X in Daltons (use 100 as average molecular weight of an amino acid). 4. (10 prs) How did the mutation at nucleotide 981 change the secquence of protein x? This mutation obviously had a detrimental effect on the function of the protein x. Provide an explanation for this dekterious effecet. 5. (25) You have been tokd that scientists isolated a mouse eDNA that encoded a protcin similar to that encoded by the human gene x. Assume it is your task to isolate the normal mouse eDNA for gene x. Design an experiment to do this. If you choose to screen a library, make sure to indicate 1) from what mouse tissue you would isolate the mRNA for your cDNA ibrary construction 2) what probe you would use to screen the library. Be brief and to the point. 6. (25) Assume you are a genetic counselor and the family with the G to A base change (already has one child effected with Syndrome X) is expecting a child and inquires if a prenatal diagnosis could be done to determine if this chikl were affected. The clones, general knowkdge concerning the mutation in this family and current state of the art of biotechnology, design a prenatal test for this family. Be brief and to the point. Pedigree of A Syndrome X Famly 1004 GOCTcceTATCCACCARSAGCTreecerTCTTCAASTCTATGAAC Alaserleuser ThelyaderPhePeePhePheAanserNetAee 155 101 151 201 251 201 351 1049 GTCAACCccerorCATCACAGAGCATGTTTICcCCMcCCAACICT ValkantroleuserserGinsacMetPhesertrotrokanser 170 CAGC GAS 1094 ATCtcorcCAZGAGCATGrCorocAGCATGGrGcccrCAGCAGTG ieserserMetserMetsersersetMetvaltrederalaval 185 451 501 GAGO AGO 1139 ACAGOCrcecocccreCACTCTCAACAGCCIGAATAACTIGAAC Met GiuThrAsscya cCCAAACTOGTGTccacerarerSCAATTAGgtaagaaccecet AretyalevalderAlacyavaiGinies 15 114 AACCrGAGTAGCceGreae TGAATTCescsorscCGAcaccrsce Aanieuserder7roferteukanserAlavaltrothrtrokle 235 teteetg tgtgtttcegtttcagAGAARGATAAAAGE ClulysAsplysser 20 1229 TGTCCTTACGEGccsccGACTCCrecOTATOTATAGGGACACG CyatretyralaProProthedretrotyrvaityrargaspThr 230 CAGCAGGGGAAGRATGAGGACGTOsacGcCGAGGACCCorCTAAG CiEcinciyiyaksnGiukapvaliyAaGluaapproserLys 44 1274 TOEAACTCGAGCCroscCAGcTGAGACTGAAAGCAAAGCAGCAC CysAserserteAiaserleuaretealyaAleiysolatis 245 35 AAGAAGCOOCAAAG CACTETACSARCCAOCAG 50 1319 TCCAGCTIcoactAcocCAocoICCAGAAALCOGCCrCCAACCIG Serser PheblytyrAlafervalGIalyatroAlaserEAleu 260 734 SICCACCARCTOCAPGCCACECCAGAGGAACCOCTAcccOGAC 65 1364 AGTGCIoCCAGIATOCACIcACCGacccaTeTA, GCCOCACCCAC SecAlacysGintyEAiavalAspargrovaistop 271 TGAAA 1411 AGCGCCGGGAT 1461 GACTGGGAATTATO 1511 1561 1611 ATGTCCACACGCGAAGAAATCGCTOTG GACCAACCTTACOGAA AGAGAAA AGCTOCT 79 ACTGAATC GAGAAGCTATATA TGATTCA CACATT AACAT TATA 1711 1761 1011 1861 1911 1961 GT 2011 ATAACA 2041 AATGTG 2111 AAAAM SESSGAGTECStgapccagescggagtet cecttgecce AlaargvalArg 24 GAGCAA aacegeccocagEGGTICAAGAATCSICGGGECAAATGSAGA MAAAAAA AAGAGGGASCGCAACCAGCAGSCCGAGCTATGCAAGAATGGCTTC 110 Fig I Nucleotide and deduced amino acid sequence of the human gene x. In sequence (shown in lower case) was determined only at intron-exon junctio 125 The start (ATG) and stop (TGA) codons are in boldface, as are the conser gt and ag sequences flanking each intron and the polyadenylation signals in 140 untranslated region Multiple stop codons S from the initiation methionine a underlined GGGCcGCASITCAATGoacICATGCAGCeCTACGACGACATOTAC GlyPreGiaPheasnciyleuhetGlaProtyrAspaspnetTyr 914 CCAGGCTATICCTACAACAACtcoceoCCAAGGGCCTTACATCe PreGlytyrsertyrAnnAantepaianlalysGlyleutarSer 159 Question 1 The information listed below summarizes the current state of our knowledge concerning Syndrome X All of the data presented are real. The actual name of the syndrome has been fäbricated so as not to deprive our students of the intellectual joy derived from utilizing the data to formulate responses to the questions that follow the summary given below. D Syndrome X is a human genetic disorder that results from a defect at one genetic locus and parients with the disorder manifest pleiotropic effects that occur during embryonie development. These effects include malformation of the anterior of the cye (which causes the eye disease known as glaucoma in 50%% of Syndrome X patients), mild head and face malformations and underdeveloped teeth. One of the pedigrees used to determine the mode of inheritance of the disorder is found below. b) Families displaying the disease were examined for linkage of the disease locus to a polymorphic site unique to each family. From such studies scientists were able to report linkage of the gene that is defecuve in the disorder to chromosome 4. (From this point on we will use the term "gene x" to designate the normal form of the gene that is defective in Syndrome X.) ) Investigators used positional cloning strategies, a methodology for isolating a cDNA clone coding for a gene when one knows nothing about the function of the protein encoded by the gene and has no probe for use in screening a CDNA library, and ultimately isolated a full length CDNA clone coding for the nomal gene x. Subsequently, they isolated a human genomic clone coding for gene x. Pedigree of A Syndrome X Fa mily 28
Expert Answer:
Answer rating: 100% (QA)
Based on the information provided I will answer your question Question 1 What is the mode of inherit... View the full answer
Related Book For
Posted Date:
Students also viewed these accounting questions
-
The information listed below refers to the employees of Lemonica Company for the year ended December 31, 2016. The wages are separated into the quarters in which they were paid to the individual...
-
The information listed below refers to the employees of Brennan Company for the year ended December 31, 2013. The wages are separated into the quarters in which they were paid to the individual...
-
The information listed below refers to the employees of Brennan Company for the year ended December 31, 2018. The wages are separated into the quarters in which they were paid to the individual...
-
A. What is the expected dividend in two years? Suppose NI = $85,000 B. What is Samsung's WACC? Samsung's capital structure is 65% ordinary equity and 35% debt. He has operating assets equal to...
-
Vest Corporation sells and issues 100 shares of its $10 par value common stock at $11 per share. Show how this transaction would be recorded in the accounting equation.
-
Shea & Gould, a prominent New York law firm of 230 attorneys, was formed in the early 1960s by William A. Shea, a prominent attorney. Shea Stadium was named after him for his efforts in forming the...
-
Search popular business magazines (Business Week, Fortune, Forbes) for an article that describes a dysfunctional behavior resulting from a poorly designed manager ial reporting and performance...
-
Tex Kinkaids dream was to develop the biggest produce operation with the widest selection of fresh fruits and vegetables in northern Texas. Within three years of opening Minigarden Produce, Inc.,...
-
A retailer reports the following for its geographic divisions for the year. Americas Europe China Income..... Sales...... $ 300,000 $ 80,000 $60,000 1,000,000 400,000 240,000 1. Compute profit margin...
-
What is an eccentric riveted joint? Explain the method adopted for designing such a joint? A bracket, attached to a vertical column by means of four identical rivets, is subjected to an eccentric...
-
if the fair value of an item of property, plant and equipment increases, is the increase included in profit and loss.
-
A CDO of $ 1 0 0 million notional value with five year maturity has the following structure respectively: Tranche, Size ( million ) , Spread ( bps ) , O / C target, I / C target A 6 0 1 0 0 1 . 3 5 1...
-
If you purchase $ 1 0 0 , 0 0 0 of office furniture, how much can you deduct from your taxes by depreciating the furniture over 7 years using both the straight line and double declining balance...
-
Describe the concept of pinch analysis in the context of energy integration within a chemical plant, and explain how this technique can be used to optimize energy consumption.
-
Compute the cost of the ending inventory and the cost of goods sold under FIFO, LIFO, and average-cost. (Round per unit cost to 3 decimal places, e.g. 15.647 and final answers to O decimal places,...
-
Air Quall Test Corporation provides on - site air quality testing services. The company provided the following cost formulas and actual results for the month of February: Fixed Component per Month...
-
Develop the procurement plan specific to this case-study. (Avoid making a generic one) Remember to check the rubric carefully to know the marking criteria. Use sub-headings as discussed in class....
-
Outline a general process applicable to most control situations. Using this, explain how you would develop a system to control home delivery staff at a local pizza shop.
-
In the Continuing Payroll Problem A, presented at the end of succeeding chapters, you will gain experience in computing wages and salaries and preparing a payroll register for Kipley Company, Inc., a...
-
Are there any exceptions to the protection afforded older workers by the Age Discrimination in Employment Act?
-
On the financial statements prepared at the end of its first year of operations, the company must show an accurate picture of all expenses and all liabilities incurred. The last payday of the year...
-
You can settle a debt with either a single payment now of \($30,000\) or with payments of \($8,000\) at the end of each of the next five years. If money is worth 10%, what is the relative advantage...
-
Explain how to convert before-tax cash operating expenses and depreciation deductions into after tax amounts.
-
What amounts are compared in net present value analysis? State the related decision rule.
Study smarter with the SolutionInn App