Unequal genetic exchanges can generate duplications and deletions (chose the best answer) Select one: O A....
Fantastic news! We've Found the answer you've been seeking!
Question:
Transcribed Image Text:
Unequal genetic exchanges can generate duplications and deletions (chose the best answer) Select one: O A. Both a duplication and a deletion can be created by the same event O B. Deletions never involve coding sequences O C. Deletions are typically advantageous because they reduce the size of chromosomes O D. Duplications never involve coding sequences O E. A deletion on one chromosome is always associated with a duplication on the homologous chromosome Unequal genetic exchanges can generate duplications and deletions (chose the best answer) Select one: O A. Both a duplication and a deletion can be created by the same event O B. Deletions never involve coding sequences O C. Deletions are typically advantageous because they reduce the size of chromosomes O D. Duplications never involve coding sequences O E. A deletion on one chromosome is always associated with a duplication on the homologous chromosome
Expert Answer:
Answer rating: 100% (QA)
Duplication is a type of chromosomal anomaly where a fragment of the chromatid co... View the full answer
Related Book For
Posted Date:
Students also viewed these biology questions
-
On rare occasions, a chromosome can suffer a small deletion that removes the centromere. When this occurs, the chromosome usually is not found within subsequent daughter cells. Explain why a...
-
The following are two DNA sequences from homologous genes: TTGCATAGGCATACCGTATGATATCGAAAACTAGAAAAATAGGGCGATAGCTAGTATGTTATCGAAAAGTAGCAAAATAGGGCGATAGCTACCCAGACTACCGGAT The two sequences, however, do...
-
The homologous chromosomes align independently at the equator during meiosis so a. All possible combinations of alleles can occur in the gametes. b. Only the parental combinations of gametes can...
-
Ice Cool produces two different models of air conditioners. The activities, costs, and cost drivers associated with the production processes follow. Budgeted Activity Usage 7,600 Activity Machining...
-
What does the term religion mean under the First Amendment?
-
A mixture of 54.5 mol% benzene in chlorobenzene at its bubble point is fed continuously to the bottom plate of a column containing two theoretical plates. The column is equipped with a partial...
-
What pleadings the defendant may file in response to the complaint?
-
The Blazon Manufacturing Companys costing system has two direct- cost categories: direct materials and direct manufacturing labor. Manufacturing overhead (both variable and fixed) is allocated to...
-
Information about KC's clients follows: AC DC MC JC RC BC Total number of 225 520 295 110 390 1,050 units purchased Number of 5 20 6 9 18 actual orders Number of written 10 20* 9 12 24 36 orders...
-
A cross-flow molecular filtration device equipped with a mesoporous membrane is used to separate the enzyme lysozyme from a fermentation broth, as shown in the figure (right column). Water at...
-
Research a U.S.-based company that manufactures technology products. Recommend one (1) approach that your selected company can take in order to lower the direct labor costs of technology products...
-
Explain the various synchronization mechanisms used in multi-threaded environments, such as mutexes, semaphores, and condition variables. How do these mechanisms impact system performance and...
-
Mealmix Berhad (Mealmix) is a FTSE Top 100 Index company in the food delivery business with its shares listed on the Main Market of the Bursa Malaysia. The Board of Mealmix consists of a...
-
Explain the concept of virtual memory. How does it enable processes to run as if they have a large, contiguous memory space? What are the roles of page tables and TLBs in this context ?
-
Compare and contrast different file systems used in modern operating systems, such as NTFS, ext4, and Btrfs. How do they differ in terms of data integrity, journaling, and performance ?
-
Monica is a manufacturer of handcrafted wooden signs. The variable cost of each wooden sign Monica produces is $ 4 0 . Monica sells her wooden signs to a wholesaler at a 5 0 % margin, who then sells...
-
A construction company sells a house with a FMV of $ 600 comma 000 to a shareholder of the corporation for $ 475 comma 000. The shareholder is liable for income tax on the $ 125 comma 000 difference....
-
Provide a few individual examples who revealed what aspects of emotional intelligence?
-
Why might government provision of insurance lead to a larger number of insurance claims than private provision of insurance would?
-
Suppose that a state mandates that both women and men be provided family leave by their employers following the birth of a child. a. How would you empirically test how this policy change affected the...
-
Think back to Chapter 5. Why can the public good provision problem be thought of as an externality problem?
-
There are two sections of an introductory statistics course. Section A has 25 students and section B has 30 students. All students took the same final exam. The mean score in section A was 82 and the...
-
Addison has been told that her average on six homework assignments in her history class is 85. She can find only five of the six assignments, which have scores of 91, 72, 96, 88, and 75. What is the...
-
A data set has a median of 17, and six of the numbers in the data set are less than 17. The data set contains a total of n numbers. a. If n is odd, and exactly one number in the data set is equal to...
Study smarter with the SolutionInn App