4. View Animation 4.9 Polymerase Chain Reaction. a. The primers used for PCR are typically how...
Fantastic news! We've Found the answer you've been seeking!
Question:
Transcribed Image Text:
4. View Animation 4.9 Polymerase Chain Reaction. a. The primers used for PCR are typically how many nucleotides long? b. In PCR, the machine cycles between three different temperatures. What are the three temperatures and what happens at each temperature? c. How many copies of target DNA are theoretically generated from a single template after 25 cycles? d. The annealing temperature used in PCR is determined by the length and base pair composition of the oligonucleotide primer. A quick way to estimate the annealing temperature to use for an oligonucleotide is to add 4°C for each G or C and 2°C for each A or T in the oligonucleotide. What would be the annealing temperature if the sequence of the oligonucleotide primer was ATCTGAGTCATAGGTCAGAC? 4. View Animation 4.9 Polymerase Chain Reaction. a. The primers used for PCR are typically how many nucleotides long? b. In PCR, the machine cycles between three different temperatures. What are the three temperatures and what happens at each temperature? c. How many copies of target DNA are theoretically generated from a single template after 25 cycles? d. The annealing temperature used in PCR is determined by the length and base pair composition of the oligonucleotide primer. A quick way to estimate the annealing temperature to use for an oligonucleotide is to add 4°C for each G or C and 2°C for each A or T in the oligonucleotide. What would be the annealing temperature if the sequence of the oligonucleotide primer was ATCTGAGTCATAGGTCAGAC?
Expert Answer:
Answer rating: 100% (QA)
a The primers used for PCR are typically 2030 nucleotides long b In PCR the machine cycles between t... View the full answer
Related Book For
Posted Date:
Students also viewed these accounting questions
-
What are the criteria for good primers in a PCR reaction?
-
Polymerase chain reaction (PCR) is a technology that requires high temperatures to reproduce DNA fragments. Explain why the discovery of thermophilic archaea and their associated DNA polymerases was...
-
In the polymerase chain reaction used to amplify DNA, some sequences of DNA produced are too long and others are the right length. Denote the number of overly long pieces after t generations of the...
-
Use the Chain Rule to calculate d/dt (r(t)) at the value of t given. f(x, y) = x = xy, r(t) = (R R - 41), t = 4
-
What kind of entity might request an attestation report on internal control, and why?
-
An increasing number of companies are using variable costing in their corporate annual reports. Do you agree? Explain.
-
What are multilateral trading platforms?
-
Whetzel Corporation reported net income of $152,000, declared dividends on common stock of $50,000, and had an ending balance in retained earnings of $360,000. Common stockholders equity was $700,000...
-
Explain the 3 primary indgredients of just in time and how it can be used in a transportation company....
-
The Scottie Sweater Company produces sweaters under the "Scottie" label. The company buys raw wool and processes it into wool yarn from which the sweaters are woven. One spindle of wool yarn is...
-
Assume you are a small business owner (you can determine the name of the product or service you provide). How would you go about setting a price for your product or service? Explain your process and...
-
Factor completely. K 3x3 + 3x - 36x
-
Primary Structure: Protein Structure: There are four levels of protein folding: primary, secondary, tertiary, and quaternary. The four levels are Amino acids represented in the diagram to the right....
-
Scholes Systems supplies a particular type of office chair tolarge retailers such as Target, Costco, and Office Max. Scholes isconcerned about the possible effects of inflation on itsoperations....
-
What is the order of preparing trial balances? Here is a partial worksheet for the Zeidman Security Services Company. Required: Fill in the income statement and balance sheet sections of the...
-
Brand X is a popular clothing brand that has been in business for over a decade. In recent years, the brand has experienced a decline in sales and brand recognition. A new marketing team has been...
-
Write the following program in ARM Assembly: Given an array of integers, return the index of the largest integer in the array $ ./find_max_index 5 4 3 2 1 C: 0 Asm: 0 $ ./find_max_index 1 2 3 4 5 C:...
-
One hundred pounds of water at atmospheric pressure are heated from 60F to 200F. What is the enthalpy change? The internal energy change? Why is the difference between the internal energy change and...
-
Draw a simple model of the following molecules: CH 4 , NaCl, H 2 O. Provide a definition of polar molecule, and identify the polar molecule listed here.
-
a. Explain why over the years the incidence of HIV infection has declined in the United States while the prevalence of AIDS has increased. b. Summarize the four drugs used in HIV therapy today, and...
-
a. Draw a diagram illustrating whether or not each of the following transfusions would be immunologically compatible. Type A donor into a type B recipient Type B donor into a type AB recipient Type O...
-
Under U.S. GAAP, research and development costs are expensed as incurred; however, in the natural resource industry, the cost of finding and developing natural resources may be capitalized to the...
-
Under U.S. GAAP, an asset that is impaired should be written down in value, with an equivalent loss taken on the income statement. Discuss how you would determine whether an assets value was impaired...
-
Under U.S. GAAP, the interest cost associated with borrowings used in the self-construction of a business asset may be capitalized to the balance sheet as part of the self-constructed assets cost...
Study smarter with the SolutionInn App