A hypothetical base sequence of an RNA molecule is 5AUUUGCCCUAGCAAACGUAGCAAACG3 Using two of the three underlined parts

Question:

A hypothetical base sequence of an RNA molecule is 5′–AUUUGCCCUAGCAAACGUAGCAAACG–3′ Using two of the three underlined parts of this sequence, draw two possible stem-loop structures that might form in this RNA.

Fantastic news! We've Found the answer you've been seeking!

Step by Step Answer:

Related Book For book-img-for-question

Genetics Analysis And Principles

ISBN: 9781260473063

7th Edition

Authors: Robert Brooker

See More Books

Question Posted: Apr 05, 2024 05:00 AM

See More Questions

Proteins are synthesized with a particular amino acid sequence through the translation of information encoded in messenger RNA by an RNAprotein complex called a ribosome. Amino acids are specified by...
CANMNMM January of this year. (a) Each item will be held in a record. Describe all the data structures that must refer to these records to implement the required functionality. Describe all the...
The new line character is utilized solely as the last person in each message. On association with the server, a client can possibly (I) question the situation with a client by sending the client's...
In Exercises 6780, begin by graphing the square root function, f(x) = x. Then use transformations of this graph to graph the given function. h(x) = x + 1 1 Vx+1-1
Assume a company uses a plantwide predetermined manufacturing overhead rate, which is calculated using direct labour hours as the cost driver. The use of this plantwide predetermined MOH rate has...
Identify the specific sections in PepsiCo's 2010 annual report where horizontal and vertical analyses of financial data are presented.
This case is a continuation of the Burburr Resorts & Hotels Corporation serial case that began. The components of the Burburr serial case can be completed in any order. Burburr has several properties...
Kelly's Tavern serves Shamrock draft beer to its customers. The daily demand for beer is normally distributed, with an average of 20 gallons and a standard deviation of 4 gallons. The lead time...
(a) The equity share of VCC Ltd. is quoted at Rs. 210. A 3-month call option is available at a premium of Rs. 6 per share and a 3-month put option is available at a premium of Rs. 5 per share....
Within living cells, many different proteins play important functional roles by binding to DNA. Some proteins bind to DNA but not in a sequence-specific manner. For example, histones are proteins...
An antibiotic is a drug that kills or inhibits the growth of microorganisms. The use of antibiotics has been of great importance in the battle against many infectious diseases caused by...
List two unbiased estimators and their corresponding parameters.
Errors in a trial balance may only be caused by an error in posting the journal entries to the accounts. True False
Which of the following payments made by a lessee to a lessor are lease payments (as defined by IFRS 16)?
An increase in production levels within a relevant range most likely would result in Increasing the total cost . Increasing the variable cost per unit. Decreasing the total fixed cost . Decreasing...
JamCo, a domestic corporation, operates abroad through three wholly - owned foreign corporations, JamFor 1 , JamFor 2 , and JamFor 3 . Each entity is organized in a different foreign country. During...
What term is used to describe the financial metric that compares a company's market value per share to its earnings per share? A. Market ratio B. Earnings ratio C. Price-to-Earnings ratio D....
Students in the fluid mechanics lab at Penn State University use the device in the figure to measure the viscosity of water: a tank and a capillary tube. The flow is laminar and has negligible...
The Thomas Corporation was organized on Jan. 1, 2020. On Dec. 31, 2021, the corporation lost most of its inventory in a warehouse fire before the year-end count of inventory was to take place. just...
How have performance metrics changed over the past 10 years?
Do you believe that players who take performance-enhancing drugs are cheating? Who is actually hurt by a player taking performance-enhancing drugs?
Usually are awarded to the successful party, but are always given at the discretion of the court. Two Types of Costs: 1) Party/party costs are calculated according to Schedule C in the Rules of...

A hypothetical base sequence of an RNA molecule is 5AUUUGCCCUAGCAAACGUAGCAAACG3 Using two of the three underlined parts

Question:

Step by Step Answer:

Here are two possible stemloop structures that cou...View the full answer

Genetics Analysis And Principles

Students also viewed these Sciences questions