The sequence of the sense strand of a mammalian gene is
TATAATACGCGCAATACAATCTACAGCTTCGCGTAAATCGTAGGTAAGTTGTAATAAATATAAGTGAGTATGATACAGGCTTTGGACCGATAGATGCGACCCTGGAGGTAAGTATAGATTAATTAGCACAGGCATGCAGGGATATCCTCCAAAAAG GTAAGTAACCTTACGGTCAATTAATTCAGGCAGTAGATGAATAAACGATATCGATCGGTTAGGTAAGTCTGAT
Determine the sequences of the mature RNA and the encoded protein. Assume that transcription initiates at a G approximately 25 bp downstream of the TATAATA sequence, that each 5' splice site has the sequence AG/GUAAGU, and that each 3' splice site has the sequence CAG/G (where / marks the location of the splice).