What amino-acid sequence would result if the following messenger RNA sequence were translated from left to right?

Question:

What amino-acid sequence would result if the following messenger RNA sequence were translated from left to right?
AGAGUCCGAGACUUGACGUGA

Fantastic news! We've Found the answer you've been seeking!

Step by Step Answer:

Related Book For book-img-for-question

General Chemistry

ISBN: 978-1439043998

9th edition

Authors: Darrell Ebbing, Steven D. Gammon

See More Books

Question Posted: Mar 01, 2016 05:33 AM

See More Questions

In this chapter, we considered a computer program that can translate a DNA sequence into a polypeptide sequence. A researcher has a sequence file that contains the amino acid sequence of a...
The 5 terminus of a human mRNA has the following sequence: 5-GAAGAGACAAGGTCAUGGCCAUAUGCUUGUUCCAAUCGUUAGCUGCGCAGGAUCGCCCUGGG. . . . . . 3 When this mRNA is translated, what amino acid sequence will be...
A partial (5 subterminal) nucleotide sequence of a prokaryotic mRNA is as follows: 5-.....AGGAGGCUCGAACAUGUCAAUAUGCUUGUUCCAAUCGUUAGCUGCGCAGGACCGUCCCGGA.. . . . . 3 When this mRNA is translated, what...
Which one of the following is NOT an example of cash flows in operating activities according to direct method? Select one: a. Cash payment for purchase of inventories b. Cash received from debtors c....
What are the three basic types of startup ideas? What are the most common sources of inspiration for startup ideas?
A soccer player kicks the ball with an initial velocity of 22.3 m/s [14 degrees above the horizontal] on a level playing field. Determine the soccer balls: a) total hang time b) maximum height...
According to Figure 1.2, the EU is a major customer of exports from Africa and the Middle East. What types of products do you think these areas produce for export, and why do you think the EU is...
Graymont Industries purchases Solvate, a chemical compound used in several of its products, from ChemMaster. ChemMaster has just increased the list price of Solvate to $6.50 per gallon. However,...
You will invest $ 2 0 0 per year. If the rate is 9 . 0 8 % , how much will you have in 1 8 years?
A sample of 61 houses recently listed for sale in Silver Spring, Maryland, was selected with the objective of developing a model to predict the taxes (in $) based on the asking price of houses (in...
Write the structural formulas of all possible tripeptides with the composition of two glycines and one serine. (See the structural formulas in Table 24.2.)
Give one of the nucleotide sequences that would translate to the peptide lysproalaphetrpgluhisgly.
Use Algorithm 4.5 with n = m = 5 to approximate the integrals in Exercise 3. Compare the number of functional evaluations required to the number required in Exercise 4. In Exercise 3 T/4 (2y sin cos2...
Banana Tree is a stable firm operating in a matured industry. The firm is currently financed with $1,806 million (market value) of bonds with a yield of 8.5% that mature next day. It has 100 million...
1. Which types of globulins are present in the blood? A) alpha and gamma B) beta and gamma C) alpha and beta D) alpha, beta, and gamma 2. Which type of globulin refers to antibodies? A) beta B) alpha...
Chaz Corporation has taxable income in 2 0 2 3 of $ 1 , 3 1 2 , 0 5 0 for purposes of computing the 1 7 9 expense and acquired the following assets during the year: Asset Placed in Service Basis...
Lowlife Company defaulted on a $ 2 5 0 , 0 0 0 loan that was due on December 3 1 , 2 0 2 1 . The bank has agreed to allow Lowlife to repay the $ 2 5 0 , 0 0 0 by making a series of equal annual...
4. How did Von Behring and Kitasato demonstrate the existence ofantibodies? A) They showed that serum from immunized rabbits could preventdisease in mice B) They discovered antibodies in mucosal...
Solve the given problems. Use a ruler and protractor as in Examples 6 and 7. A driver takes the wrong road at an intersection and travels 4 mi north, then 6 mi east, and finally 10 mi to the...
AB CORPORATION ISSUED THE FOLLOWING 850 COMMON STOCKS PAR VALUE P100 750 PARTICIPATING PREFERRED STOCKS PAR VALUE P100 AT 3% AB CORPORATION DECLARED P100,000.00 DIVIDEND IN 2022.
Find the transfer impedance Vo(s) / Is (s) for the network shown in fig 11.4. 2 0 is(t) 2H 4
Find the driving point impedance at the input terminal of the circuit in fig 11.5. lF 362 3 3 3 1
Draw the bode plot for the network function.
Have a brief introduction, discussion of the topics/points, and a conclusion.what you have learned during the course( Organizational Dynamics and Effectiveness).Their relevance to your career....
Using the article provided below, you are required to analyse the company information to define the business goals and evaluate whether the supply chain is a strategic fit with the business and...
Create output that shows a scatterplot with a line of best fit for your data. Explain what a line of best fit is? Submit both the output file (SPSS) as well as your Word summary.

What amino-acid sequence would result if the following messenger RNA sequence were translated from left to right?

Question:

Step by Step Answer:

Mark off the message into triplets beginning at the left Th...View the full answer

General Chemistry

Students also viewed these Organic Chemistry questions