What is shareholders equity? What are its main components?
Question:
Fantastic news! We've Found the answer you've been seeking!
Step by Step Answer:
Answer rating: 76% (13 reviews)
Shareholders equity is the residual interest in the asset...View the full answer
Answered By
DIPAK BHOYE
"I am a M.sc (organic chemistry) from NMU India and also a BSc graduate from The University of NMU, india.
I have many years of tutoring experience and I enjoyed teaching all grades students. I have been tutoring with other tutoring sites also and has a very good circle of more than 500 students from USA UK India and some other from South Asia tool am doing one to one tutoring also and like to teach Reactions and mechanism all subjects specially network problem wisi etc and i also like tutoring physics.chemistry Maths and Chemistry subjects and i have also tutoring many students for SAT exam So love tutoring and can taught all grades student. Many of my students' parents message me that your lessons improved our children's grades . So loving tutoring. I love eating and that too of different cuisines. I made many self-papers for this exam which include the basics of chemistry and elementary of all chemistry topics. Initially I worked as a Research Associate at The University of NMU Maharashtra and While at The University I assisted professors with their research work, preparation of course material on corporate finance and equity analyst
0.00
0 Reviews
10+ Question Solved
Related Book For
Intermediate Accounting
ISBN: 978-0071339476
Volume 1, 6th Edition
Authors: Beechy Thomas, Conrod Joan, Farrell Elizabeth, McLeod Dick I
Question Posted:
Students also viewed these Accounting questions
-
What are the main components of attitudes? Are these components related or unrelated?
-
What are the main components of a companys cost of capital? Rank these components from lowest to highest cost (a) On a before-tax and (b) On an after-tax cost basis, and explain why these differences...
-
What is equity? What are the three components of shareholders equity? Explain each component.
-
Claud Chapperon is a self-employed distributor of wholesale clothing who began trading on 1 July 2012. His summarised accounts for the year to 30 June 2020 are shown below. The figures in brackets...
-
What is a mineral and a rock? Why are pure metals not minerals?
-
Pacifico Company, a U.S.-based importer of beer and wine, purchased 1,500 cases of Oktoberfest-style beer from a German supplier for 390,000 euros. Relevant U.S. dollar exchange rates for the euro...
-
Myers, Montgomery and Anderson-Cook (Response Surface Methodology 4th edition, Wiley, New York, 2016) discuss an experiment to determine the influence of five factors:$x_{1}$ - acid bath temperature...
-
Harrelson Inc. currently has $750,000 in accounts receivable, and its days sales outstanding (DSO) is 55 days. It wants to reduce its DSO to 35 days by pressuring more of its customers to pay their...
-
state the accounting investment tools any business can use and the SWOT analysis?
-
The May transactions of Chulak Corporation were as follows. May 4 Paid $700 due for supplies previously purchased on account. 7 Performed advisory services on account for $6,800. 8 Purchased supplies...
-
Under what circumstances may a liability be offset against a related asset, such as offsetting a bank note payable against cash in bank?
-
Explain the difference between a contingency and a provision for future costs.
-
Your grandfather is copilot of a bomber, flying horizontally over level terrain, with a speed of 275 m/s relative to the ground, at an altitude of 3 000 m. (a) The bombardier releases one bomb. How...
-
Saying that a quantitative trait exhibits a continuum means that a. the numerical value for the trait increases with the age of the individual. b. environmental effects are additive. c. the...
-
The government has today imposed a price ceiling on gasoline purchased at the pump. As one member of Congress said, It was done to keep gasoline prices within the reach of the poor and the...
-
An antibiotic is a drug that kills or inhibits the growth of microorganisms. The use of antibiotics has been of great importance in the battle against many infectious diseases caused by...
-
With regard to the CRISPR-Cas system that defends bacteria against bacteriophage attack, what happens during the adaptation, expression, and interference phases? When a bacterium is exposed to a...
-
A hypothetical base sequence of an RNA molecule is 5AUUUGCCCUAGCAAACGUAGCAAACG3 Using two of the three underlined parts of this sequence, draw two possible stem-loop structures that might form in...
-
An investor is considering two bonds. One is a corporate bond yielding 12%, and is currently selling at par. The marginal tax rate is 28%. The other is a municipal bond with a coupon rate of 9.50%....
-
(a) Given a mean free path = 0.4 nm and a mean speed vav = 1.17 105 m/s for the current flow in copper at a temperature of 300 K, calculate the classical value for the resistivity of copper. (b)...
-
Figure P24.36 shows a cross section through an infinitely long, uniformly charged hollow cylinder. How does the magnitude of the electric field vary with the radial distance \(r\) from the cylinder's...
-
Identify at least two situations in which application of different accounting methods or accounting estimates results in difficulties in comparing companies.
-
Identify at least two situations in which application of different accounting methods or accounting estimates results in difficulties in comparing companies.
-
Identify at least two situations in which application of different accounting methods or accounting estimates results in difficulties in comparing companies.
-
I Z X (b) List three factors that increase compressive strength of intact rock material in laboratory testing: (c) List two factors that influence the stress distribution around a circular tunnel....
-
Assignment 1.1 - Rock Mass Classification Underground excavations are to be done in the granite, sandstone and mudstone. Rock mass qualities of granite, sandstone and mudstone are to be assessed...
-
What is the minimum volume in m^3 of clay required for the development with the following characteristics? Creating a foundation layer for 1-hectare commercial development Gs=2.65 Dry unit weight=...
Study smarter with the SolutionInn App