Which type of adjustment will? (a) Increase both assets and revenues, (b) Increase revenues and decrease liabilities,
Question:
(a) Increase both assets and revenues,
(b) Increase revenues and decrease liabilities,
(c) Increase expenses and decrease assets,
(d) Increase both expenses and liabilities?
Fantastic news! We've Found the answer you've been seeking!
Step by Step Answer:
Answer rating: 63% (22 reviews)
a Accrued revenueassets and revenues are increased when an adjusting entry recognizes a r...View the full answer
Answered By
Tobias sifuna
I am an individual who possesses a unique set of skills and qualities that make me well-suited for content and academic writing. I have a strong writing ability, allowing me to communicate ideas and arguments in a clear, concise, and effective manner. My writing is backed by extensive research skills, enabling me to gather information from credible sources to support my arguments. I also have critical thinking skills, which allow me to analyze information, draw informed conclusions, and present my arguments in a logical and convincing manner. Additionally, I have an eye for detail and the ability to carefully proofread my work, ensuring that it is free of errors and that all sources are properly cited. Time management skills are another key strength that allow me to meet deadlines and prioritize tasks effectively. Communication skills, including the ability to collaborate with others, including editors, peer reviewers, and subject matter experts, are also important qualities that I have. I am also adaptable, capable of writing on a variety of topics and adjusting my writing style and tone to meet the needs of different audiences and projects. Lastly, I am driven by a passion for writing, which continually drives me to improve my skills and produce high-quality work.
5.00+
1+ Reviews
10+ Question Solved
Related Book For
Cornerstones of Financial and Managerial Accounting
ISBN: 978-1111879044
2nd edition
Authors: Rich, Jeff Jones, Dan Heitger, Maryanne Mowen, Don Hansen
Question Posted:
Students also viewed these Accounting questions
-
How is the amount for an interest expense (or interest revenue) adjustment determined?
-
Identify each of the following categories of accounts as temporary or permanent: assets, liabilities, equity, revenues, expenses, dividends. How is the distinction between temporary and permanent...
-
Provide two examples of transactions that begin and end at a particular point in time and two examples of continuous transactions.
-
Whitmore Company issued $500,000 of 5-year, 8% bonds at 97 on January 1, 2020. The bonds pay interest annually. Instructions a. 1. Prepare the journal entry to record the issuance of the bonds. 2....
-
In regard to the capital asset pricing model, comment on disagreements or debates related to RF (the risk-free rate) and KM (market rate of return).
-
A portion of the coding sequence of a cloned gene is shown here: 5GCCCCCGATCTACATCATTACGGCGAT3 3CGGGGGCTAGATGTAGTAATGCCGCTA5 This portion of the gene encodes a polypeptide with the amino acid...
-
Let us consider an economy with two risky assets with returns \(\tilde{r}_{1}\) and \(\tilde{r}_{2}\). Show that the explicit formula \(w=\left(\mu-\mathbb{E}\left[\tilde{r}_{2} ight] ight)...
-
The 2009 financial statements of 3M Company report net sales of $23.1 billion. Accounts receivable (net) are $3.2 billion at the beginning of the year and $3.25 billion at the end of the year....
-
In the automobile industry, the dimensionless drag coefficient and the area of the vehicle are often combined into one variable - the drag area whereby the drag area is the product of the...
-
Several years ago, management at Tuglar Corporation established a grievance committee composed of employees who volunteered to work toward the amicable resolution of disputes between Tuglar...
-
How does accrual-basis net income differ from cash-basis net income?
-
Describe the effect on the financial statements when an adjustment is prepared those records (a) Unrecorded revenue (b) Unrecorded expense.
-
Nationally, the distribution of weapons used in robberies is as shown in the table. The data on the following page represent the weapon of choice in 1652 robberies on school property. (a) Does the...
-
XYZ Co. completed construction of a new silver mine in 2020. The cost of direct materials for the construction was $2,500,000 and direct labour was $2,300,000. In addition, the company allocated...
-
12/45 Evaluate, 3/15 +2/30
-
Miriam is putting $5,000 per year into an IRA and increases her deposits by 4% each year. Right now her account has $28,593 in it. Suppose that going forward her account earns 8.95% and inflation...
-
Define with examples, also states that what are the machines corresponding to each of the following 1. What do you mean by a Context-free language? 2. What do you mean by a Context-sensitive...
-
Based on "World Trade Statistical Review 2023" https://www.wto.org/english/res_e/publications_e/wtsr_2023_e.htmLinks to an external site. Discuss the following questions in relation to this WTO...
-
After t hours on the job, one factory worker is producing Q' 1 (t) = 60 2(t 1) 2 units per hour, while a second worker is producing Q' 2 (t) = 50 5t units per hour. a. If both arrive on the job at...
-
Refrigerant-134a enters an adiabatic compressor as saturated vapor at 120 kPa at a rate of 0.3 m3/min and exits at 1-MPa pressure. If the isentropic efficiency of the compressor is 80 percent,...
-
A stockbroker has proposed two investments in low rated corporate bonds paying high interest rates and selling below their stated value (in other words, junk bonds), Both bonds are rated as equally...
-
Three mutually exclusive alternatives are being considered. Each alternative has a 20-year useful life with no salvage value . If the minimum attractive rate of return is 7%, which alternative should...
-
A firm is considering the following alternatives, as well as a fifth choice: do nothing. Each alternative has a 5-year useful life. The firm's minimum attractive rate of return is 8%. Which...
-
What strategies might you use to implement the personal change needed to support organizational change? What is the relevance of unity consciousness in organizational leadership, communications, and...
-
Recognizing the literature (and its limitations) for conveying policing organization, management, and change - what management/organizational changes are needed in policing today? Why? How do we set...
-
How do organizations effectively navigate the complexities of organizational change, integrating advanced change management methodologies to mitigate resistance and foster sustainable transformation?
Study smarter with the SolutionInn App