What are some of the ethical issues associated with using regression to predict individuals future behavior?
Question:
What are some of the ethical issues associated with using regression to predict individuals’ future behavior?
Fantastic news! We've Found the answer you've been seeking!
Step by Step Answer:
Answer rating: 83% (12 reviews)
Two business scenarios modified from Glover Bumpus Logan and Seasla were used to assess ethical inte...View the full answer
Answered By
Ifsha akhlaq
I have different types of experiences in different departments such as I have 2 years of experience as a hospital pharmacist. I have 4 years of experience as a quality control manager and research officer in a nutraceutical industry. I have tutoring experience of 7 years in a college and online teaching.
0.00
0 Reviews
10+ Question Solved
Related Book For
Statistics For The Behavioral Sciences
ISBN: 9781319190743
5th Edition
Authors: Susan A. Nolan, Thomas Heinzen
Question Posted:
Students also viewed these Business questions
-
What are some of the ethical issues that arise when a firm becomes overly zealous in advertising its products?
-
What are some of the ethical issues that may arise from a firms procurement activities? Are you aware of any of these issues from your personal experience or businesses you are familiar with?
-
What are some of the ethical issues involved in cross-cultural marketing?
-
What is true about business cycles? Multiple select question. They vary in duration and intensity. They follow an identical pattern. They are made up of alternating rises and declines. "Ups" are...
-
What amino-acid sequence would result if the following messenger RNA sequence were translated from left to right? AGAGUCCGAGACUUGACGUGA
-
Imagine that you are an executive working for a company that distributes books to bookstores in the Seattle, Washington, area. Your company, with a 20,000-squarefoot warehouse and a fleet of 15 small...
-
The following are the 2018 financial statements for Omni Company, with almost all dollar amounts missing: The following information is available about Omni Company's financial statements: 1. Quick...
-
Recognition of Revenue'Bonus Dollars Griseta & Dubel Inc. was formed early this year to sell merchandise credits to merchants who distribute the credits free to their customers. For example,...
-
The following information is for Cheyenne Ltd. for the year ended June 30, 2024. CHEYENNE LTD. Statement of Financial Position As at June 30 2024 2023 Assets Current assets: Cash $66,100 $47,300...
-
Recording Adjusting Entries Hannah Companys annual accounting year ends on June 30. It is June 30, 2012, and all of the entries for the current year have been made except the following adjusting...
-
In what ways have regression tools been used to predict individuals future behavior?
-
A meta-analysis found a negative correlation between birth weight and blood pressure later in life (Mu et al., 2012). a. Explain what is meant by a negative correlation between these two variables....
-
The stress-strain diagram for many metal alloys can be described analytically using the Ramberg-Osgood three parameter equation = /E + ko n , where E, k, and n are determined from measurements taken...
-
a. Plot the series. What can you learn from examining this plot? b. Calculate and display the first 24 autocorrelations for the series. What do the ACF and PACF suggest about the series? c. Suggest a...
-
If you deposit $400 each year for 8 years in an account that pays 7%, How much will you have at the end of the 8 years? Use the TVM keys on your calculator... NOT the tables in the book Carry answer...
-
3) Find these terms of the sequence {an}, where an -2 (-3)" +5". a) ao b) a c) 24 d) as Answer: a) 3 b) c) d)
-
On January 2 of the current year, BC Co. acquired 1,000 shares of its $10 par value common stock for $20,000. On July 1, BC exchanged this stock for land to be held for use as the site of the...
-
A firm has three categories of budgeted overhead costs. Supervisor Salaries: $ 7 5 0 , 0 0 0 Equipment Lease: $ 1 9 0 , 0 0 0 Maintenance: $ 7 5 , 0 0 0 After an activity - based costing study, the...
-
Williams-Santana Inc. is a manufacturer of high-tech industrial parts that was started in 2004 by two talented engineers with little business training. In 2018, the company was acquired by one of its...
-
Inexhaustible collections of ONPOs are not required to be capitalized or depreciated, if certain criteria are met. Why is this so, and what accounting and reporting recognition, if any, is required...
-
Why would you think that it would be wise to include Gender in that regression?
-
Since you have the DASL data on brain size, note that it also includes the variables of height and weight. Predict weight from height and sex and compare with the answer for Exercise 11.17.
-
In examples like the Guber study on the funding of education, we frequently speak of variables like PctSAT as nuisance variables. In what sense is that usage reasonable here, and in what sense is it...
-
an initial deposit of $5,000 is made into a savings account that compounds 7.1% interest annually. How much is in the account at the end of five years?
-
Find the betas of two firms and discuss whether the betas are what you would expect. Then discuss how the returns could be calculated based on the CAPM model. Be sure to state your assumptions.
-
The average daily pay for Tortuga Travel's employees = $589. The adjusting entry to record accrued vacation pay for two days includes: a. a debit to Vacation Benefits Payable = $1,178. b. a credit to...
Study smarter with the SolutionInn App