Crunch-Time Cereal Company manufactures two breakfast cereals in a joint process. Cost and quantity information follows: Required:
Question:
Crunch-Time Cereal Company manufactures two breakfast cereals in a joint process. Cost and quantity information follows:
Required:
Use the following methods to allocate the company's joint production cost between Yummies and Crummies:
1. The physical units method.
2. The relative sales value method.
3. The constant gross margin method.
Transcribed Image Text:
Sales price per kilogram Quantity at split-off point Cereal Joint Cost 12 000 kilograms 8 000 kilograms $6.00 Yummies $120 000 $7.50 Crummies
Fantastic news! We've Found the answer you've been seeking!
Step by Step Answer:
Answer rating: 73% (15 reviews)
1 Physical units method Joint cost Joint products Quantity at splitoff point Relative ...View the full answer
Answered By
Muhammad Salman Alvi
Well, I am a student of Electrical Engineeing from Information Technology University of Punjab. Just getting into my final year. I have always been good at doing Mathematics, Physics, hardware and technical subjects. Teaching profession requires a alot of responsibilities and challenges.
My teaching experience started as an home tutor a year ago. When I started teaching mathematics and physic subjects to an O Level student. He was about 14 years old. His name was Ibrahim and I used to teach him for about 2 hours daily. Teaching him required a lot of patience but I had to be polite with him. I used to give him a 5 min break after 1 hour session. He was quite weak in basic maths and calculation. He used to do quite a lot of mistakes in his homework which I gave him weekly. So I decided to teach him basics from scratch. He used to say that he got the concept even if he didn't. So I had to ask him again and again. I worked on his basics for a month and after that I started taking a weekly test sesions. After few months he started to improve gradually. Now after teaching him for about a year I can proudly say that he has improved alot. The most important thing was he managed to communicate all the difficullties he was facing. He was quite capable and patient. I had a sincere desire to help him reach to its full potential. So I managed to do that. We had a very good honest relationship of a student and a teacher. I loved teaching him as a tutor. Now having an experience of one year teaching I can read students quite well. I look forward to work as an online tutor who could help students in solving their all sort of difficulties, problems and queries.
4.90+
29+ Reviews
43+ Question Solved
Related Book For
Management Accounting
ISBN: 9781760421144
7th Edition
Authors: Kim Langfield Smith, Helen Thorne, David Alan Smith, Ronald W. Hilton
Question Posted:
Students also viewed these Advanced Accounting questions
-
Breakfast time Cereal Company manufactures two breakfast cereals in a joint process. Cost and quantity information is as follows: Required: Use the physical-units method to allocate the companys...
-
Breakfasttime Cereal Company manufactures two breakfast cereals in a joint process. Cost and quantity information is as follows: Required: Use the physical-units method to allocate the companys joint...
-
Refer to the data given in Exercise 19.30. Crunch-Time Cereal Company has an opportunity to further process its Crummies into a mulch for ornamental shrubs. The additional processing operation costs...
-
The trial balance for Hanna Resort Limited on August 31 is as follows: Additional information: 1. The balance in Prepaid Insurance includes the cost of four months premiums for an insurance policy...
-
Quantum solid in a quantum solid the dominant repulsive energy is the zero-point energy of the atoms. Consider a crude one-dimensional model of crystalline He4 with each he atom confined to a line...
-
Write the sequences of the two 12-residue primers that could be used to amplify the following DNA segment by PCR. ATAGGCATAGGCCCATATGGCATA AGGCTTTATAATAT- GCGATAGGCGCTGGTCAG
-
Madison Corporation (Madison) along with Sarah, Madisons chief executive officer (CEO), and James, Madisons chief financial officer (CFO), engaged in a practice known as using dummy assets to inflate...
-
The trial balance of Large Company, Inc. at the end of its annual accounting period is as follows: Additional information: 1. Expired insurance, $600. 2. Unused supplies, per inventory, $800. 3....
-
For this exercise, instead of using the values in the challenge, ask the user for the number of shares, the share price, and the percent commission.For this exercise, instead of using the values in...
-
This exercise explores the differences between agent functions and agent programs. a. Can there be more than one agent program that implements a given agent function? Give an example, or show why one...
-
Iron Man Cleaning Company produces cleaning compounds and solutions for industrial and household use. While most of its products are processed independently, a few are related. Grit 337, a coarse...
-
The New South Wales Division of Sansuki Motor Corporation (SMC) manufactures sub-assemblies that are used in their final products. Lynn Hardt of the New South Wales Division's Profit Planning...
-
Find the volume of the solid in the first octant bounded by the coordinate planes, the cylinder x 2 + y 2 = 4, and the plane z + y = 3.
-
Does the emergence of hybrid gangs indicate that the juvenile gang is a form of organized crime?
-
Is there such a thing as the born criminal? Are some people programmed at birth to commit crimes?
-
Is conflict inevitable in all cultures? If not, what can be done to reduce the level of conflict in our own society?
-
Discuss the characteristics of antisocial youths. Do you know anyone who fits the description?
-
What policy might be the best strategy to reduce teenage drug use: Source control? Reliance on treatment? National education efforts? Community-level enforcement? Harm reduction measures?
-
Find the critical value t c for the level of confidence c and sample size n. c = 0.95, n = 12
-
Outline some of the major problems confronting an international advertiser.
-
The wireless phone manufacturing division of a consumer electronics company uses activity-based costing. For simplicity, assume that its accountants have identified only the following three...
-
Cambridge Tool Co. is a supplier that assembles purchased parts into components for three distinct marketsscooter parts, lawn mower parts, and hand tool parts. Following is the statement of operating...
-
The Hernandez Manufacturing Company has two producing departments, machining and assembly. Mr. Hernandez recently automated the machining department. The installation of a CAM system, together with...
-
The following trial balance was drawn from the records of Zachary Company as of October 1, year 2. Cash Accounts receivable Inventory Store equipment Accumulated depreciation Accounts payable Line of...
-
Calculate the number of units sold and units remaining in ending inventory. Book "rint erences Check my wa Car Armour sells car wash cleaners. Car Armour uses a perpetual inventory system and made...
-
Eliminating Entries, Goodwill Pendragon Corporation acquired all of the stock of Sherwood, Inc. for $500 million in cash. Sherwood's shareholders' equity accounts at the date of acquisition were as...
Study smarter with the SolutionInn App