List the six most important trends of the general environment. Give a hypothetical example of a way
Question:
Fantastic news! We've Found the answer you've been seeking!
Step by Step Answer:
Answer rating: 53% (13 reviews)
The six general trends are economic trends sociocultural trends politicallegal trend...View the full answer
Answered By
Muhammad Haroon
More than 3 years experience in teaching undergraduate and graduate level courses which includes Object Oriented Programming, Data Structures, Algorithms, Database Systems, Theory of Automata, Theory of Computation, Database Administration, Web Technologies etc.
5.00+
3+ Reviews
10+ Question Solved
Related Book For
Small Business Management Launching & Growing Entrepreneurial Ventures
ISBN: 978-1133947752
17th edition
Authors: Justin Longenecker, William Petty, Leslie Palich, Frank Hoy
Question Posted:
Students also viewed these Management Leadership questions
-
List the six most important trends of the general environment. What are some ways in which each trend might affect a small business?
-
Give a hypothetical example where Company A buys Company B for a 15.0% premium.
-
Give a hypothetical example where Company A buys Company B for a 15.0% discount.
-
Stuart and Belinda, who earn good salaries, want to buy a property they can use to live in and operate a bed and breakfast in their retirement. The only funds they have available is their combined...
-
What amino-acid sequence would result if the following messenger RNA sequence were translated from left to right? AGAGUCCGAGACUUGACGUGA
-
Suppose you receive $100 at the end of each year for the next three years. a. If the interest rate is 7%, what is the present value of these cash flows? b. What is the future value in three years of...
-
What are the causes of exchange-rate volatility? Have these problems become greater or lesser in the past 20 years? Explain why.
-
Blaxo Balloons manufactures and distributes birthday balloons. At the beginning of the year Blaxos common stock was selling for $20 but by year end it was only $18. If the firm paid a total cash...
-
If there are 70,000,000 shares outstanding, what is the impact on the market value of the firm? Projections for a firm whose stock you wish to value: Years 1 - 7 Years 8 - 11 Years 12 - 24 EPS 2.35...
-
Demello & Associates records adjusting entries on an annual basis. The company has the following information available on accruals that must be recorded for the year ended December 31, 2017: 1....
-
List and describe the 10 approaches outlined in this chapter that can be used to generate creative new business ideas. What are the most important features of each of these?
-
What are the primary factors that shape competition in an industry, according to Porters model? In your opinion, which of these factors will have the greatest impact on industry prices and profits?
-
Visit Twitter and record which hashtags are most active at this time. Are there other "trending topics" that aren't associated with hashtags? What do you think of the activity in these areas? Is...
-
Jackie is a pharmacy technician. She receives a faxed prescription for a Schedule II drug for a patient in a long-term care facility. She questions her supervisor about the prescription. Robert, her...
-
Action figures usually cost $12.00 are on sale for two for $15.00, how much do you save when you buy two? Show your calculations.
-
Ada Yonath has been assigned to prepare reports that will help top management decide which business units and segments should be kept and which should be sold or just shut down. Ada has been told to...
-
McGarity Company plans to sell 32500 special commemorative dolls with fixed costs of $354000 per year and variable expenses at 60 percent of sales. What is the contribution margin ratio for McGarity...
-
A buyer purchased 120 solid swim suits at $42 cost and place a retail of $90 of them. 60 printed swim suits are also purchased at $30 each. What retail price is needed on the printed swim suits to...
-
What is meant by the cost-benefit constraint when developing managerial accounting systems?
-
Presented below are income statements prepared on a LIFO and FIFO basis for Kenseth Company, which started operations on January 1, 2024. The company presently uses the LIFO method of pricing its...
-
Name a company that seems large but might be classified as small because it has relatively little impact on its industry.
-
Large businesses depend on small businesses. Why?
-
Define outsourcing, and describe its impact on small business.
-
Closet Links Clothing Company provided the following manufacturing costs for the month of June. Direct labor cost $ 132 comma 000$132,000 Direct materials cost 82 comma 00082,000 Equipment...
-
You have the following information about Burgundy Basins, a sink manufacturer. Equity shares outstanding 20 million Stock price per share $ 30 Yield to maturity on debt 7.5 % Book value of...
-
Suppose in its income statement for the year ended June 30, 2017, The Clorox Company reported the following condensed data (dollars in millions). Salaries and wages expenses $ 480 Research and...
Study smarter with the SolutionInn App