Portions of eukaryotic mRNA sequence that are removed during RNA processing are ________. a. Exons b. Caps

Question:

Portions of eukaryotic mRNA sequence that are removed during RNA processing are ________.

a. Exons

b. Caps

c. Poly-A tails

d. Introns

Fantastic news! We've Found the answer you've been seeking!

Step by Step Answer:

Related Book For answer-question

Concepts Of Biology

ISBN: 9781938168116

1st Edition

Authors: Samantha Fowler, Rebecca Roush, James Wise

See More Books

Question Posted: Sep 23, 2022 01:54 AM

See More Questions

A eukaryotic cell carrying out transcription and RNA processing is incubated with 32P-labeled ATP. Where will the radioactive isotope appear in mature mRNA if the ATP is labeled at the (a) position,...
During RNA processing A.) All of the exons are removed and discarded B.) The RNA molecule is made from a DNA template C.) Introns are cut from the RNA and the exons are spliced together D.) The RNA...
A mRNA strand has the sequence - 5CCAUCCGGCAUACCAAAUUACUAAACUAGC3-
According to Dr. Grant, creatives are people who ________. A. Are procrastinators B. Act on multiple ideas C. Plan out each detail D. Are highly confident with no doubts about their success
The treasurer of Westmark Industrial, Inc., a wholesale distributor of household appliances, wants to estimate his companys cash balances for the first three months of 2015. Using the information...
What are some situational influences that affect your performance as a student? Would it be fair for professors to take into account situational influences when assigning grades?
On June 8, 2017, Eugene Weiner made a post on Isaac Aflalos Facebook page. The post read, Yurim and Isaac took advantage of a old 94plus sick man elder abuse [sic]. Alflalo took umbrage to the post...
Gerald Glynn manages the Michaels Distribution Center. After careful examination of his database information, he has determined the daily requirements for part-time loading dock personnel. The...
Household income in marketing surveys is often reported in brackets: for example, under $15,000, $15,000$25,000, ... , over $95,000. (a) Suppose that household income is the outcome variable in a...
Helen loans her son Ricky, $25,000 to help with the purchase of a car and other personal expenses. Due to her affection for her son, Helen charges Ricky zero interest. Which of these statements best...
The RNA components of ribosomes are synthesized in the ________. a. Cytoplasm b. Nucleus c. Nucleolus d. Endoplasmic reticulum
A promoter is ________. a. A specific sequence of DNA nucleotides b. A specific sequence of RNA nucleotides c. A protein that binds to DNA d. An enzyme that synthesizes RNA
What are the two types of systems auditors?
How does method overriding contribute to the polymorphic behavior in Java, elucidating its significance in object-oriented programming paradigms? Explain
Prove that NOR can build, : AND,OR , and NOT with Examples
In the small country of Fictionia, there are 30 workers. Each worker can produce 4 shirts in one day, or bake 1 loaf of bread. These are the only two goods the can be produced. Part A) Draw the...
Finance Problems 1) What is the initial outlay, given the following information: Equipment Price. $375,000 Installation. 10,000 Power Survey 30,000 Shipping. 8,000 Working Capital 100,000 Project...
On 2 January 2016, ME Ltd (ME) issued $10,000,000 5-year bonds for $10,811,090. The stated coupon rate is 10% per annum, and the effective interest rate is 8% per annum. Interest is to be paid...
Randomized block design yielded the following ANOVA table: a. How many blocks and treatments were used in the experiment? b. How many observations were collected in the experiment? c. Specify the...
Design a circuit which negative the content of any register and store it in the same register.
Certain proton pump inhibitors inhibit secretion of stomach acid and are among the most widely sold drugs in the world today. What pump does this type of drug inhibit, and where is this pump located?
The membrane potential in animal cells, but not in plants, depends largely on resting K + channels. How do these channels contribute to the resting potential? Why are these channels considered to be...
Patch clamping can be used to measure the conductance properties of individual ion channels. Describe how patch clamping can be used to determine whether or not the gene coding for a putative K +...
2 Find the inverse: f(x) = 3x+2
1 -1 Let A 0 2 and B 5 3 1 BA= = 0 -2 5 6 2 10 BA = 3 3 BA= 2 -2 4 -12 7 11 3 0 5 BA = -1 -26 = -3 2 1 Calculate BA. 1 -1 2
Minden Company is a wholesale distributor of premium European chocolates. The company's balance sheet as of April 30 is given below: Minden Company Balance Sheet April 30 Assets Cash Accounts...

Portions of eukaryotic mRNA sequence that are removed during RNA processing are ________. a. Exons b. Caps

Question:

Step by Step Answer:

In the process of RNA processing the introns are removed in th...View the full answer

Concepts Of Biology

Students also viewed these Life Sciences questions