Which of the following statements about common features of chordates is true? a. The dorsal hollow nerve

Question:

Which of the following statements about common features of chordates is true?

a. The dorsal hollow nerve cord is part of the chordate central nervous system.

b. In vertebrate fishes, the pharyngeal slits become the gills.

c. Humans are not chordates because humans do not have a tail.

d. Vertebrates do not have a notochord at any point in their development; instead, they have a vertebral column.

Data in Figure 15.33

Fantastic news! We've Found the answer you've been seeking!

Step by Step Answer:

Related Book For answer-question

Concepts Of Biology

ISBN: 9781938168116

1st Edition

Authors: Samantha Fowler, Rebecca Roush, James Wise

See More Books

Question Posted: Sep 26, 2022 03:00 AM

See More Questions

Which of the following statements about the project budgeting process is true? The weekly budget is formed by only using the early start times of each activity. The weekly budget is formed by only...
Which of the following statements about the online newspaper audience is not true? A) Online newspaper readership is growing at more than 10% a year. B) The majority of newspaper readers read the...
Which of the following statements about the minimum variance portfolio of all risky securities are valid? (Assume short sales are allowed.) Explain. a. Its variance must be lower than those of all...
R and Q form equal partnership RQ on February 15. Partner R has a tax year ending on July 31, whereas partner Qs tax year ends on October 31. What taxable year must the partnership use? a. February...
Imagine a wilderness area of 200 square miles in the Rocky Mountains. How would you expect each of the following factors to affect peoples total willingness to pay for its preservation? a. The size...
Backyard Shed Solutions sells its largest shed for $1,800 plus HST of 13%. On May 10, 2021, it sold 40 of these sheds. On May 17, 2021, the company sold 95 of these sheds. All sales are cash sales....
Thomas Rusnack and his then-wife, Analisa Rusnack, opened a home equity line of credit (HELOC) with Cardinal Bank in August 2003. Between 2003 and 2006, the Rusnacks periodically drew on the HELOC...
Sandi Scott obtained a patent on a small electronic device and organized Scott Products, Inc., to produce and sell the device. During the first month of operations, the device was very well received...
On a private flight with capacity for 150 people, $800,000 per person is charged, plus $25,000 for each unsold seat on the plane. How many people must travel on the plane and what will be the price...
1. How strong are the competitive forces confronting J. Crew in the market for specialty retail? Do a [Michael Porter] five-forces analysis to support your answer. (see chapter 3 in the textfor...
Which of the following is not a feature common to most animals? a. Development into a fixed body plan b. Asexual reproduction c. Specialized tissues d. Heterotrophic nutrient sourcing
Which of the following statements about the anatomy of a mollusk is false? a. Mollusks have a radula for scraping food. b. Mollusks have ventral nerve cords. c. The tissue beneath the shell is called...
In Exercises 7582, add or subtract terms whenever possible. 8A+ZA
You were recently hired to calculate a firm's WACC. The firm's capital structure is 40% debt, 45% common stock, and 15% preferred stock. The After-tax cost of debt is 3.5%, the cost of preferred...
Find the (real) eigenvalues and eigenvectors of the following matrices: 1 0 [5 11 a. A = [] - 1 - Check if V = [] is an eigenvalue for A = eigenvectors. b. B = 3 = [o 51 [2] without finding the...
Consider the following swap. Party A will pay after 6 months (182 days) a fixed rate 7.50 percent per annum on a semiannual basis, and receives from Party B LIBOR + 40 basis points. The current...
Simpson Ltd is a small IT company, which has 2 million shares outstanding and a share price of $20 per share. The management of Simpson plans to increase debt and suggests it will generate $3 million...
How does Postcolonial Theory contribute to other critical approaches like Psychoanalytic Theory and New Historicism?
Personal identification number (PIN) pads are devices that connect to point-of-sale electronic cash registers for debit and credit card purchases. Recall that for the 12 manufacturers listed in the...
Complete problem P10-21 using ASPE. Data from P10-21 Original cost ................................................................. $7,000,000 Accumulated depreciation...
In pigeons, a dominant allele C causes a checkered pattern in the feathers; its recessive allele c produces a plain pattern. Feather coloration is controlled by an independently assorting gene; the...
In mice, the allele C for colored fur is dominant over the allele c for white fur, and the allele V for normal behavior is dominant over the allele v for waltzing behavior, a form of...
In rabbits, the dominant allele B causes black fur and the recessive allele b causes brown fur; for an independently assorting gene, the dominant allele R causes long fur and the recessive allele r...
What were the key objectives that Basel Committee for banking Supervision was designed to address?How did they go about achieving such objectives? b. What key problems were identified with Basel II?...
Newport, Incorporated, used Excel to run a least-squares regression analysis, which resulted in the following output Regression Statistics Multiple R R Square Observations 0.7225 0.8500 30 5...
A particular DNA segment is sequenced in five random people drawn from the population. The results are shown in the table below: ACAAGTTTAGCACACACACATT Individual 1 Copy 1 Copy 2 ACAAGTTTAGCACACACATT...

Which of the following statements about common features of chordates is true? a. The dorsal hollow nerve

Question:

Notochord Dorsal hollow nerve cord. Pharyngeal slits Post-anal tail

Step by Step Answer:

In chordate a dorsal hollow nerve cord is present dors...View the full answer

Concepts Of Biology

Students also viewed these Life Sciences questions