Assume that you have just sequenced a small fragment of DNA that you had cloned. The nucleotide sequence of this segment of DNA is as follows. 

aagtagtcgaaaccgaattccgtagaaacaactcgcacgctccggtttcgtgttgcaacaaaataggcattcccatcgcggcagttagaatcaccgagtgcccagagtcacgttcgtaagcaggcgcagtttacaggcagca
gaaaaatcgattgaacagaaatggctggcggtaaagcaggcaaggattcgggcaaggccaaggcgaaggcggtatcgcgttccgcgcgcgcggg

In an attempt to learn something about the identity or possible function of this DNA sequence, you decide to perform a BLAST (nucleotide blast) search on the NCBI web site (http://www.ncbi.nlm.nih.gov). Paste or type this sequence into the query sequence box. Run the search and examine the sequences most closely related to your query sequence. Are they coding sequences? What proteins do they encode? Repeat the BLAST search with only half of your sequence as the query sequence. Do you still identify the same sequences in the databases? If you use one-fourth of your sequence as a query, do you still retrieve the same sequences? What is the shortest DNA sequence that you can use as a query and still identify the same sequences in the databanks?