Match the acellular particles with their distinctive characteristics. Parea las partculas acelulares con sus caractersticas distintivas?...
Fantastic news! We've Found the answer you've been seeking!
Question:
Transcribed Image Text:
Match the acellular particles with their distinctive characteristics. Parea las partículas acelulares con sus características distintivas? The type of phage that only reproduces by the lytic cycle. The host cell is always Choose... destroyed. An infectious and nonliving particle that is composed of protein and nucleic acid (particula infecciosa e inerte que está compuesta de proteína y ácido nucleico) Name given to small, circular molecules of RNA that have no protein coats that are known to cause plant diseases (nombre dado a moléculas pequeñas de RNA, desnudas, que causan enfermedades en las plantas). A virus that contains RNA as its genetic information (virus que contiene RNA como su información genética) Viral DNA that is incorporated into the bacterial chromosome (DNA viral integrado al cromosoma bacteriano). Tiny bits of misfolded protein that are thought to cause Mad Cow Disease ( moláculas pequeñas de proteínas que se cree causan la enfermedad de la vacas locas). de cél de Choose... Choose... Choose... Choose... Choose... Virus Retrovirus ( T phage + 4 Prions Lambda phage Viroid Match the acellular particles with their distinctive characteristics. Parea las partículas acelulares con sus características distintivas? The type of phage that only reproduces by the lytic cycle. The host cell is always Choose... destroyed. An infectious and nonliving particle that is composed of protein and nucleic acid (particula infecciosa e inerte que está compuesta de proteína y ácido nucleico) Name given to small, circular molecules of RNA that have no protein coats that are known to cause plant diseases (nombre dado a moléculas pequeñas de RNA, desnudas, que causan enfermedades en las plantas). A virus that contains RNA as its genetic information (virus que contiene RNA como su información genética) Viral DNA that is incorporated into the bacterial chromosome (DNA viral integrado al cromosoma bacteriano). Tiny bits of misfolded protein that are thought to cause Mad Cow Disease ( moláculas pequeñas de proteínas que se cree causan la enfermedad de la vacas locas). de cél de Choose... Choose... Choose... Choose... Choose... Virus Retrovirus ( T phage + 4 Prions Lambda phage Viroid
Expert Answer:
Answer rating: 100% (QA)
1 Bacteriophage 2 Virus 3 Viroids 4 RNA virus 5 Prophage 6 Prions Explanation 1 Bacteriophages are v... View the full answer
Related Book For
Accounting Principles
ISBN: 978-0470533475
9th Edition
Authors: Jerry J. Weygandt, Paul D. Kimmel, Donald E. Kieso
Posted Date:
Students also viewed these accounting questions
-
C13 1-4 ? 1-6. BACTERIAL GROWTH & COMPONENTS OF MACROMOLECULES Suppose you discover a one-foot black and white sphere in Central Park and you suspect it is a new organism. If it really is alive and...
-
How can factors in the micro and macro environment affect the company? Give your own concrete example from a company or an organization. Choose a micro and a macro factor.
-
Units Unit Cost January 1 2016 beginning inventory2800 800 Purchases January 6 20163500 900 January 25 20163200 950 February 17 20162600 1000 March 27 20162900 1050 A physical inventory on March 31...
-
Tort cases are so common that it is likely you or someone you know has been involved in a tort case. If so, share what the case was about, what the outcome was, and how you felt about the case and...
-
Write the amino-acid sequence obtained from left-toright translation of the messenger RNA sequence. AUUGGCGCGAGAUCGAAUGAGCCCAGU
-
The Burlington Police Department has five detective squads available for assignment to five open crime cases. The chief of detectives wishes to assign the squads so that the total time to conclude...
-
An often-ignored concept in breach of contract is the availability, if any, of the award of punitive damages. Often, cases incorporate both breach of contract and tort actions. The tort actions...
-
Messner Co. reported $145,000 of net income for 2010. The accountant, in preparing the statement of cash flows, noted several items occurring during 2010 that might affect cash flows from operating...
-
Question 2 Consider a monopsonist with the following relationship between wage and labor: and the following production function w= a+bL f(K, L) = ln(L) + In(K) (3) (4) 1. Write the short run profit...
-
In year 0, Javens, Inc. sold machinery with a fair market value of $400,000 to Chris. The machinery's original basis was $317,000 and Javens's accumulated depreciation on the machinery was $50,000,...
-
Suppose that the world's economy consists of only two risky assets (XOM and INTC) and one risk-free asset (F). The risk-free rate is currently 5%. The possible risky asset returns are described...
-
What is the user cost of capital? What variables determine this cost, and how does a change in each variable affect it?
-
One of the main characteristics of financial deepening is that more individuals participate in the financial system: more people open checking and saving accounts, and more firms rely on financial...
-
Is balancing the budget a contractionary macroeconomic policy?
-
Identify and give examples of the three components of investment spending.
-
Identify three things that can change labor demand or supply and reduce employment. How would each of these affect real wages?
-
What is the main difference between politics and government? Group of answer choices politics is a system; government is an institution politics is a process; government is an organization politics...
-
Listed below are common types of current liabilities, contingencies, and commitments: a. Accounts payable b. Bank loans and commercial paper c. Notes payable d. Dividends payable e. Sales and excise...
-
The Deep South Division operates as a profit center. It reports the following for the year. Prepare a responsibility report for the Deep South Division at December 31,2010. Budgeted $2,000,000 Actual...
-
Pherigo Co. uses special journals and a general journal. The following transactions occurred during May 2010. May 1 I. Pherigo invested $50,000 cash in the business. 2 Sold merchandise to B. Sherrick...
-
The stockholders equity accounts of Neer Corporation on January 1, 2010, were as follows. Preferred Stock (8%, $50 par, cumulative, 10,000 shares authorized) $ 400,000 Common Stock ($1 stated value,...
-
Find the state vector via the formal-solution approach. \(\dot{\mathbf{x}}=\left[\begin{array}{cc}5 & 1 \\ -4 & 1\end{array} ight] \mathbf{x}+\left[\begin{array}{c}1 \\ -1\end{array} ight] u, \quad...
-
A nonlinear dynamic system is described by a. Use the Simulink model to plot x 2 ( t ) x 2 ( t ) . b. Derive the linearized model analytically, build its Simulink model where the linear model is...
-
Consider the mechanical system in Figure 8.28. Assuming \(m=12 \mathrm{~kg}\), \(b=20 \mathrm{~N}\)-sec \(/ \mathrm{m}, k=200 \mathrm{~N} / \mathrm{m}, F_{0}=47 \mathrm{~N}\), and \(\omega=5...
Study smarter with the SolutionInn App