After recording the forecasts of your local meteorologist for 30 days, you conclude that she gave a
Question:
After recording the forecasts of your local meteorologist for 30 days, you conclude that she gave a correct forecast for 26 days. What is the probability that her next forecast will be correct?
Relative Frequency Probabilities. Use the relative frequency method to estimate the probabilities in Exercises.
Fantastic news! We've Found the answer you've been seeking!
Step by Step Answer:
Answer rating: 41% (12 reviews)
In an NPN transistor the flow of current runs from the col...View the full answer
Answered By
Dudhat Vaidehi
I tutored mostly elementary school students privately after school and during the summer. We met in their homes or at the public library. I charged an hourly fee, and I provided any necessary materials.
Having taught in special education in two local schools for many years meant that I had contact with a lot of parents of special needs students. I never had to advertise — word of mouth was how most folks knew of me. At one point I did have a website, but didn't utilize it much. I stayed very busy, especially in the summers, and always had a full schedule. I typically met with each student's teacher in order to get an idea of what the focus of my instruction/remediation should be. Becoming familiar with the student's learning style(s) was also very helpful. Often parents would share records and test results with me. After each tutoring session, I documented the student’s progress and gave parents written updates, as well as phone calls or emails as needed.
While my students and I certainly utilized technology and the internet often during our sessions, I never tutored online or for any tutoring company, so am not familiar with the curriculums or methods used in those settings.
Tutoring one on one was very enjoyable and rewarding. My students and I had fun, and grew quite fond of one another. The extra income was a bonus. I had to retire from tutoring due to a physically handicapping disease, and miss my students very much.
0.00
0 Reviews
10+ Question Solved
Related Book For
Statistical Reasoning For Everyday Life
ISBN: 978-0134494043
5th Edition
Authors: Jeff Bennett, William Briggs, Mario Triola
Question Posted:
Students also viewed these Sciences questions
-
After recording the forecasts of your local weatherman for 30 days, you conclude that he gave a correct forecast 18 times. What is the probability that his next forecast will be correct?
-
Use the inverse power method to estimate the middle eigenvalue of the A in Example 3, with accuracy to four decimal places. Set x0 = (1.0.0).
-
Use the zero-value time-constant method to estimate the small-signal dominant pole for the current gain of the MOS cascode current mirror of Fig. 4.9. Assume an input ac current source in parallel...
-
The management of a New York area investment firm wants to find out about the investment needs of its existing customers, for which it has an extensively detailed list, as a function of their...
-
Rounded to the nearest month, how long will it take an investment to triple if it earns: a. 9% compounded annually? b. 8% compounded quarterly?
-
A particular investment proposal has a payback period that exceeds the investments expected life. The investment has no salvage value . Will this proposals net present value be positive or negative?...
-
Example 6.1 used sum(wtlossdat ["B"] *wtlossdat["y"])/4 to compute the main effect of $\mathrm{C}$.a. Explain why the espression is divided by 4 ? b. Write an $\mathrm{R}$ function to calculate the...
-
A company makes two products - product A and product B which are sold at a profit per unit of $60 and $100, respectively. The three resources used to make these products are summarized in the table...
-
Rearrange the code blocks below to build a proper elif statement. Drag from here if my_var 5: elif my_var
-
Is there a role for independent-thinking, decisive, and creative leaders in a team-based organization? Explain.
-
You will find many life expectancy calculators available on the Internet; try a few of them. Do they seem to give accurate or realistic results? Explore the statistical techniques that are used to...
-
The Royal Statistical Society (headquartered in London) has proposed a system of risk magnitudes and risk factors analogous to the Richter scale for measuring earthquakes. Go to the Internet to learn...
-
What are the three economic questions which any society must answer?
-
A portion of the coding sequence of a cloned gene is shown here: 5GCCCCCGATCTACATCATTACGGCGAT3 3CGGGGGCTAGATGTAGTAATGCCGCTA5 This portion of the gene encodes a polypeptide with the amino acid...
-
Following the infection of healthy tobacco leaves by reconstituted viruses, what two characteristics did Fraenkel-Conrat and Singer analyze? Explain how their results were consistent with the idea...
-
Homologous recombination refers to the exchange of DNA segments that are a. similar or identical in their DNA sequences. b. in close proximity to one another. c. broken due to ionizing radiation. d....
-
L ets suppose you have isolated chromatin from some bizarre eukaryote that has a DNA linker region that is usually 300350 bp in length. The nucleosome structure is the same as in other eukaryotes. If...
-
A collection of recombinant vectors that carry fragments of chromosomal DNA is called a. a genomic library. b. a cDNA library. c. a Northern blot. d. either a or b.
-
Find the altitudes above the Earth's surface where Earth's gravitational field strength would be (a) Two thirds (b) One third of its value at the surface.
-
Show that, given a maximum flow in a network with m edges, a minimum cut of N can be computed in O(m) time.
-
Calculate K P at 600.K for the reaction N 2 O 4 (l) 2NO 2 (g) assuming that H o R is constant over the interval 298 725 K.
-
Consider the equilibrium CO(g) + H2O(g) ???? CO2(g) + H2(g). At 1150. K, the composition of the reaction mixture is a. Calculate K P and ÎG o R at 1150. K. b. Given the answer to part (a), use...
-
When 2,4-dibromo-3-methyltoluene is treated with bromine in the presence of iron (Fe), a compound with molecular formula C8H7Br3 is obtained. Identify the structure of this product.
-
Using two-way Set-Associative mapping method, design two-way mapping for cache memory from main memory. Explain why you need each condition and show all intermediate calculation procedures. You must...
-
18) Under the proration approach, the sum of the amounts shown in the subsidiary ledgers will not match the amounts shown in the general ledger because no adjustments from budgeted to actual...
-
Simpson Auto Body Repair purchased $20,000 of Machinery. The company paid $8,000 in cash at the time of the purchase and signed a promissory note for the remainder to be paid in four monthly...
Study smarter with the SolutionInn App