Sickle-cell anemia is an often fatal genetic condition caused by a single error in the DNA gene that codes for the b chain of hemoglobin. The correct nucleic acid sequence (read from the mRNA template) begins with AUGGUGCACCUGACUCCUGAGGAGAAG . . . , and so forth. 

(a) Translate this into the corresponding amino acid sequence of the protein. 

(b) The mutation that gives rise to the sickle-cell condition is replacement of the boldface A in the preceding sequence by U. What is the consequence of this error in the corresponding amino acid sequence? 

(c) This amino acid substitution alters the properties of the hemoglobin molecule — in particular, its polarity and its shape. Suggest reasons for both these effects.