What amino-acid sequence would result if the following messenger RNA sequence were translated from left to right?
Question:
AGAGUCCGAGACUUGACGUGA
Fantastic news! We've Found the answer you've been seeking!
Step by Step Answer:
Answer rating: 80% (10 reviews)
Mark off the message into triplets beginning at the left Th...View the full answer
Answered By
Muhammad Umair
I have done job as Embedded System Engineer for just four months but after it i have decided to open my own lab and to work on projects that i can launch my own product in market. I work on different softwares like Proteus, Mikroc to program Embedded Systems. My basic work is on Embedded Systems. I have skills in Autocad, Proteus, C++, C programming and i love to share these skills to other to enhance my knowledge too.
3.50+
1+ Reviews
10+ Question Solved
Related Book For
Question Posted:
Students also viewed these Organic Chemistry questions
-
In this chapter, we considered a computer program that can translate a DNA sequence into a polypeptide sequence. A researcher has a sequence file that contains the amino acid sequence of a...
-
The 5 terminus of a human mRNA has the following sequence: 5-GAAGAGACAAGGTCAUGGCCAUAUGCUUGUUCCAAUCGUUAGCUGCGCAGGAUCGCCCUGGG. . . . . . 3 When this mRNA is translated, what amino acid sequence will be...
-
A partial (5 subterminal) nucleotide sequence of a prokaryotic mRNA is as follows: 5-.....AGGAGGCUCGAACAUGUCAAUAUGCUUGUUCCAAUCGUUAGCUGCGCAGGACCGUCCCGGA.. . . . . 3 When this mRNA is translated, what...
-
Which one of the following is NOT an example of cash flows in operating activities according to direct method? Select one: a. Cash payment for purchase of inventories b. Cash received from debtors c....
-
What are the three basic types of startup ideas? What are the most common sources of inspiration for startup ideas?
-
Suppose a spaceship of length L 0 travels at a high speed v relative to an observer. To the observer, the ship appears to have a smaller length given by the Lorentz contraction formula where c is the...
-
A mass- \(m\) particle moves along the \(x\)-axis subject to a potential energy \(V(x)=\lambda\left[\left(x^{2}-a^{2} ight)^{2}+ ight.\) \(\left.2 a x^{3} ight]\), where \(\lambda\) and \(a\) are...
-
Marquita Filters produces an air filter for use in jet aircraft. Parts are added at several points in the production process. In August, production began with 600 filters in Work in Process, 80...
-
For the compressor linkage shown in Figure P6.19, use the relative velocity method to analytically determine the linear velocity of the piston as the crank rotates clockwise at 950 rpm. Piston 35...
-
Judge and Cable (2010) report the results of a study demonstrating a negative relationship between weight and income for a group of women professionals. Following are data similar to those obtained...
-
Write the structural formulas of all possible tripeptides with the composition of two glycines and one serine. (See the structural formulas in Table 24.2.)
-
Give one of the nucleotide sequences that would translate to the peptide lysproalaphetrpgluhisgly.
-
Universal Electric, Inc., manufactures and sells two models of lamps, L 1 and L 2 , the profit being $150 and $100, respectively. The process involves two workers W 1 and W 2 who are available for...
-
Let's assume that the nominal exchange rate between the Argentine peso and the Canadian dollar is 1,000 pesos per dollar. Furthermore, suppose that a kilogram of chopped beef costs 2.005 in Canada...
-
Question 1. Process Capability Improvement 1. Describe a (manufacturing or service) process of your choice that you intend to improve the capacity of that process. 2. Show a step-by-step procedure...
-
Suppose that consumers become pessimistic about the overall economy because of partisan politics. What would you expect to happen to the aggregate demand curve?
-
Write all corresponding letters in the column, noting that there may be more than one person able to do the task. A. Licensee-in-charge/Principal Agent B. Signatory on the trust account C....
-
Suppose that between 1995 and 2013, US external that rose from a percent of GDP to over 29% of GDP this increase in external debt owed to foreign entities ?Explain
-
Which of the following rules define y as a function of x? X 9 4 1 0 1 4 9 y 32 1 0 -1 -2 -3
-
AB CORPORATION ISSUED THE FOLLOWING 850 COMMON STOCKS PAR VALUE P100 750 PARTICIPATING PREFERRED STOCKS PAR VALUE P100 AT 3% AB CORPORATION DECLARED P100,000.00 DIVIDEND IN 2022.
-
Find the transfer impedance Vo(s) / Is (s) for the network shown in fig 11.4. 2 0 is(t) 2H 4
-
Find the driving point impedance at the input terminal of the circuit in fig 11.5. lF 362 3 3 3 1
-
Draw the bode plot for the network function.
-
A company that produces candy has commissioned a time study for the bagging station where 4 operators work to carry out the task (all of them are dedicated to bagging). The product consists of a...
-
Compare international and domestic terrorism versus individuals who attack due to shared ideologies. Based on your reading and experience, do you believe the United States (specifically the...
-
After reading the articles about the mail bombs sent out during the 2018 midterm elections, explain the role of Emergency Management and Homeland Security in this scenario about parcel (supply chain)...
Study smarter with the SolutionInn App