A safe is loaded onto a truck whose bed is 5.50 ft above the ground. The safe
Question:
A safe is loaded onto a truck whose bed is 5.50 ft above the ground. The safe weighs 538 lb.
(a) If the effort applied is 140 lb, what length of ramp is needed?
(b) What is the MA of the inclined plane?
(c) Another safe weighing 257 lb is loaded onto the same truck. If the ramp is 21.1 ft long, what effort is needed?
Fantastic news! We've Found the answer you've been seeking!
Step by Step Answer:
Answer rating: 78% (14 reviews)
a Length F R heightF E 538 lb 550 ...View the full answer
Answered By
Charles mwangi
I am a postgraduate in chemistry (Industrial chemistry with management),with writing experience for more than 3 years.I have specialized in content development,questions,term papers and assignments.Majoring in chemistry,information science,management,human resource management,accounting,business law,marketing,psychology,excl expert ,education and engineering.I have tutored in other different platforms where my DNA includes three key aspects i.e,quality papers,timely and free from any academic malpractices.I frequently engage clients in each and every step to ensure quality service delivery.This is to ensure sustainability of the tutoring aspects as well as the credibility of the platform.
4.30+
2+ Reviews
10+ Question Solved
Related Book For
Applied Physics
ISBN: 978-0132109277
10th Edition
Authors: Dale ewen, Neill schurter, P. erik gundersen
Question Posted:
Students also viewed these Mechanics questions
-
A kite 100 ft above the ground moves horizontally at a speed of 8 ft/s. At what rate is the angle between the string and the horizontal decreasing when 200 ft of string have been let out?
-
A batter hits a baseball 3 ft above the ground toward the center field fence, which is 10 ft high and 400 ft from home plate. The ball leaves the bat with speed 115 ft/s at an angle 508 above the...
-
A hot-air balloon is 150 ft above the ground when a motorcycle (traveling in a straight line on a horizontal road) passes directly beneath it going 40 mi/hr (58.67 ft/s). If the balloon rises...
-
Using the information for Sarot, Inc., in SE 4 and SE 5, compute the current ratio, quick ratio, receivable turnover, days sales uncollected, inventory turnover, days inventory on hand, payables...
-
What peptide would be synthesized from the following DNA sequence? 5TTACCGACTGGTCACTCCCAT3
-
Can hydrogen or deuterium emit an particle? Explain.
-
Subsidiaries of First of America, a major commercial bank, have made loans to First of America directors and executive officers. The loans totaled \($56,965,000\) at December 31, 1999 (3.6 percent of...
-
On January 1, 2018, the general ledger of Grand Finale Fireworks includes the following acccount balances: During January 2018, the following transactions occur: January 9 January 10 January 12...
-
Using the EDGAR database, a document that includes data and analysis of Deferred Taxes. If you selected Target Corp. look at 10-K (annual reports) and 10-Q (quarterly reports) and open the May 28,...
-
Curtis Walker admired his wife's success at selling scarves at local crafts shows, so he decided to make two types of plant stands to sell at the shows. Curtis makes twig stands out of downed wood...
-
An inclined plane is 10.0 m long and 2.50 m high. (a) Find its mechanical advantage. (b) A resistance of 727 N is pushed up the plane. What effort is needed? (c) An effort of 200 N is applied to push...
-
1. A 3.00-m-long plank is used to raise a cooling unit 1.00 m. What is the MA of the ramp made by the plank? 2. A 2.75-m-long board is used to slide a compressor a vertical distance of 0.750 m. What...
-
Why should the timing of direct materials purchases be closely coordinated with the production budget?
-
Explain why melting ice caps cause Earths temperature to rise. (Hint: Use the term albedo.)
-
Heat waves kill more people in the United States than all of the other natural disasters combined. Why do heat waves mainly kill people who live in cities?
-
How is a volcano like a shaken bottle of soda?
-
Why do hurricanes die when they reach land?
-
In what way do plants reduce the threat of global warming?
-
Using the chained-dollar method, compare the growth rates of nominal GDP and real GDP in 2016. TABLE 2 (a) In 2015: Item Food Fun (b) In 2016: Item Food Fun Quantity 100 50 Quantity 75 65 Price $2 $6...
-
What are current assets and current liabilities? How are they different from non-current assets and non-current liabilities?
-
What risks do alliances pose to partner firms?
-
A man wearing ice skates throws and 8-kg block with an initial velocity of 2 m/s, measured relative to himself, in the direction shown. If he is originally at rest and completes the throw in 1.5 s...
-
The barge weighs 45 000 lb and supports two automobiles A and B which weigh 4000 lb and 3000 lb, respectively, if the automobiles start from rest and drive towards each other, accelerating at BA = 4...
-
The barge B weighs 30 000 lb and supports and automobile weighing 3000 lb. if the barge is not tied to the pier P and someone drives the automobile to the other side of the barge for unloading...
-
Suppose the correlation between the stock euro returns of Siemens and the USD/EUR exchange rate is 0.2. The standard deviation of the USD/EUR is 10% and the standard deviation of Siemens's stock euro...
-
list and describe the three key client-related factors that the advisor is required to consider when developing a "suitable" investment portfolio for their client. Please cite resources used
-
Year 1 2 3 Amount ($) 2000 3000 4000 An investment made today will pays you the above cash flows at the end of each year. If your required rate of return is 5% annual interest, how much will you pay...
Study smarter with the SolutionInn App