1. A 3.00-m-long plank is used to raise a cooling unit 1.00 m. What is the MA...
Question:
1. A 3.00-m-long plank is used to raise a cooling unit 1.00 m. What is the MA of the ramp made by the plank?
2. A 2.75-m-long board is used to slide a compressor a vertical distance of 0.750 m. What is the MA of the ramp made by the board?
Fantastic news! We've Found the answer you've been seeking!
Step by Step Answer:
Answer rating: 60% (15 reviews)
1 MA length height 3...View the full answer
Answered By
Nyron Beeput
I am an active educator and professional tutor with substantial experience in Biology and General Science. The past two years I have been tutoring online intensively with high school and college students. I have been teaching for four years and this experience has helped me to hone skills such as patience, dedication and flexibility. I work at the pace of my students and ensure that they understand.
My method of using real life examples that my students can relate to has helped them grasp concepts more readily. I also help students learn how to apply their knowledge and they appreciate that very much.
4.00+
1+ Reviews
10+ Question Solved
Related Book For
Applied Physics
ISBN: 978-0132109277
10th Edition
Authors: Dale ewen, Neill schurter, P. erik gundersen
Question Posted:
Students also viewed these Mechanics questions
-
A 7-hp (shaft) pump is used to raise water to an elevation of 15 m. If the mechanical efficiency of the pump is 82 percent, determine the maximum volume flow rate of water.
-
A double-scissor lift table is used to raise a 450-kg machine component. The table consists of a platform and two identical linkages on which hydraulic cylinders exert equal forces. (Only one linkage...
-
A 7-hp (shaft) pump is used to raise water to an elevation of 15 m. If the mechanical efficiency of the pump is 82 percent, determine the maximum volume flow rate of water.
-
Climate-change concerns are resulting in investment in fuels that dont produce greenhouse gases. Although solar and wind power garner a lot of attention, nuclear power from uranium is also a...
-
A mRNA strand has the sequence - 5CCAUCCGGCAUACCAAAUUACUAAACUAGC3-
-
Define and discuss the idea of separating risk into two parts. Describe each part carefully?
-
Cheese Please Ltd produces cheese topping for the fast pizza industry. At the beginning of April, 20 000 kilograms of cheese topping was in process, 100% complete as to raw materials and 60% complete...
-
Miriam is a self-employed computer consultant. Her business nets $120,000 annually and she takes $85,000 of the earnings in salary. Miriam is considering incorporating her computer consulting...
-
Before automation became more prevalent, overhead was often calculated and allocated as a function of direct labor costs or direct labor hours. Discuss whether you feel this method of allocation is...
-
A construction firm from the Phuket Province of Thailand has a five activity project lined up for the coming month. They have had some difficulty getting firm estimates on the activity durations and...
-
A safe is loaded onto a truck whose bed is 5.50 ft above the ground. The safe weighs 538 lb. (a) If the effort applied is 140 lb, what length of ramp is needed? (b) What is the MA of the inclined...
-
A resistance of 325 N is raised by using a ramp 5.76 m long and by applying a force of 75.0 N. (a) How high can it be raised? (b) Find the MA of the ramp.
-
David Cheung is an operations manager for a large manufacturer. He earned $68,500 in 2012 and plans to contribute the maximum allowed to the firms 401(k) plan. Assuming that David is in the 25...
-
Marketers like to conduct surveys to better understand their customer base. How accurate do you think surveys are? Think about a survey ad you saw or a survey you were obligated to take at school,...
-
We are playing special cards, which have the usual four suits (Spades, Hearts, Clubs, and Diamonds) but the ranks can be any positive integer. You have been delivered a hand of n cards, and you have...
-
Question 1 5 Points Pizza Planet is a well-known family pizza restaurant located in the Tri-County Area and has earned its reputation as a fun place for kids with its space-themed design, and its...
-
Would it be reasonable for the Tonor company to use secondary data in their market research, instead of primary data? Provide two reasons for your answer, relating to the definitions of primary and...
-
Suppose you are the root user and you have a shell script file (config.sh). The details of the file are shown below: -rwxrwxrwx 1 root root 0 Nov 9 16:40 config.sh You would like to remove the write...
-
An athletic trainer is most likely subject to both specific hazard standards and the general duty clause of OSHA. True or False
-
Sundial Technologies produces and sells customized network systems in New Brunswick. The company offers a 60-day, all software and labor-and an extra 90-day, parts-only- warranty on all of its...
-
How do alliances serve as a vehicle for corporate strategy?
-
The block A has a mass of 2 kg and slides into an open ended box B with a velocity of 2 m/s. If the box has a mass of 3 kg and rests on top of a plate P that has a mass of 3 kg, determine the...
-
The block A has a mass of 2 kg and slides into and open ended box B with a velocity of 2m/s. If the box has a mass of 3 kg and rests on top of a plate P that has a mass of 3 kg, determine the...
-
The man M weighs 150 lb and jumps onto the boat B which has a weigh of 200 lb. if he has a horizontal component of velocity relative to the boat of 3 ft/s, just before he enters the boat, and the...
-
What is the yield to maturity of a 23-year bond that pays a coupon rate of 8.25% per year, has a $1,000 par value , and is currently priced at $1,298.05?
-
Suppose the exchange rate between U.S. dollars and Swiss francs is SF 1.112 = $1.00, and the exchange rate between the U.S. dollar and the euro is $1.00 = 0.9842 euros. What is the cross-rate of...
-
Use the following information for the Lowell, Inc. for this and the next two questions. Sales $200,000 Debt 95,000 Dividends 5,000 Equity 40,000 Net income 16,000 1.What is the company's...
Study smarter with the SolutionInn App