Describe how nucleotide substitutions at different positions in codons affect the characteristics of the encoded amino acids?
Question:
Fantastic news! We've Found the answer you've been seeking!
Step by Step Answer:
Answer rating: 63% (11 reviews)
a Changes in the third position of a codon infrequently ch...View the full answer
Answered By
Gauri Hendre
I worked as EI educator for Eduphy India YT channel. I gave online tutorials to the students who were living in the villages and wanted to study much more and were preparing for NEET, TET. I gave tutions for topics in Biotechnology. I am currently working as a tutor on course hero for the biochemistry, microbiology, biology, cell biology, genetics subjects. I worked as a project intern in BAIF where did analysis on diseases mainly genetic disorders in the bovine. I worked as a trainee in serum institute of India and Vasantdada sugar institute. I am working as a writer on Quora partner program from 2019. I writing on the topics on social health issues including current COVID-19 pandemic, different concepts in science discipline. I learned foreign languages such as german and french upto A1 level. I attended different conferences in the science discipline and did trainings in cognitive skills and personality development skills from Lila Poonawalla foundation. I have been the member of Lila poonawalla foundation since 2017. Even I acquired the skills like Excel spreadsheet, MS Office, MS Powerpoint and Data entry.
5.00+
4+ Reviews
10+ Question Solved
Related Book For
Fundamentals of biochemistry Life at the Molecular Level
ISBN: 978-0470547847
4th edition
Authors: Donald Voet, Judith G. Voet, Charlotte W. Pratt
Question Posted:
Students also viewed these Medical Sciences questions
-
The following apparatus can be used to measure atomic and molecular speed. Suppose that a beam of metal atoms is directed at a rotating cylinder in a vacuum. A small opening in the cylinder allows...
-
A homologous DNA region, which was 20,000 bp in length, was sequenced among four different species. The following number of nucleotide differences were obtained: Construct a phylogenetic tree that...
-
Let's suppose a DNA mutation changes the consensus sequence at the -35 location in a way that inhibits factor binding. Explain how a mutation could inhibit the binding of factor to the DNA. Look at...
-
A thermocouple Type K is calibrated in lab condition at 50% relative humidity (RH) prior to outdoor operation. After 12-month in outdoor installation, the thermocouple is again tested at 75% RH. Both...
-
Florences daughter, Eunice, needs $5,000 to start a business. Florence agrees to give her the money but will have to sell some securities to raise that much cash. Florence has 1,200 shares of Tom...
-
The boiling point of nitrogen N2 is 77.35 K. Express this temperature in degrees Fahrenheit.
-
What advantages are there to using social media sites for informal discovery? How may the information you find help in settling a civil lawsuit?
-
Soft tissue follows an exponential deformation behavior in uniaxial tension while it is in the physiologic a normal range of elongation. This can be expressed as Where = stress, = strain, and E o...
-
How do strategic leaders effectively navigate the complexities of geopolitical risk, regulatory compliance, and geopolitical risk, and sustainability imperatives to build resilient global supply...
-
Second National Insurance Company provided this information for its minority-passive equity securities: Required: 1. Provide the journal entries to record the fair value adjustment on December 31,...
-
Identify the polypeptide encoded by the DNA sequence below, in which the lower strand serves as the template for mRNA synthesis? 5 GGACCTATGATCACCTGCTCCCCGAGTGCTGTTTAGGTGGG 3 3'...
-
What two reactions are carried out by aminoacyl-tRNA synthetases?
-
Verify that \(\left|\Delta v_{\mathrm{u} x} ight| /\left|\Delta v_{\mathrm{s} x} ight| \approx 1 / 3\) for the two carts in Figure 4.9. Figure 4.9 Velocity-versus-time graph for a standard cart and a...
-
In which way does this book cover CPS and IoT design?
-
Which challenges must be overcome in order to fully take advantage of the opportunities?
-
Which description techniques can be used for capturing initial ideas about the system to be designed?
-
How could we model design flows?
-
Why are we interested in energy-aware computing?
-
Why are competitors typically far more likely to accuse firms of monopolization than customers?
-
7 A 29-year-old, previously healthy man suddenly collapses at a party where legal and illicit drugs are being used. Enroute to the hospital, he requires resuscitation with defibrillation to establish...
-
In what naturally occurring nucleic acids would you expect to find A-form helices, B-form helices, Z-form helices, nucleosomes, and circular DNA?
-
What are the two principal opposing views regarding the patenting of genes?
-
What two genes are at the heart of a current lawsuit and what is their importance?
-
Novak Company has the following stockholders' equity accounts at December 31, 2025. Common Stock ($100 par value, authorized 7,600 shares) $459,100 Retained Earnings 266,700 (a) Your answer is...
-
After reviewing the speech on new computer software that he willmake to project managers, Ira decides that it is boring. Hesearches for jokes and funny stories that are somehow related toparts of his...
-
Two vectors, , and , are drawn on an coordinate system, as shown. Vector has a magnitude of 9.00 units, and vector has a magnitude of 5.00 units. Find the and of vectors and in the system. Compute...
Study smarter with the SolutionInn App