Develop your own worksheet for the Butler inventory simulation model shown in Figure. Suppose that management prefers
Question:
FIGURE EXCEL WORKSHEET FOR THE BUTLER INVENTORYPROBLEM
Transcribed Image Text:
PortaCom Risk Analysis Lil 3 Sel ling Price per Unit 4 Administrative Cost $249 5400,000 600,000 5 Advertising Cost 7 Direct Labor Cost wer Parts Cost (Uniform Distribution) $80 S100 Upper Smallest Value 9Random No. Random No. Cost per Unit Largest Value 0.0 12 13 14 15 0.3 0.7 0.9 $43 $44 $45 $46 $47 0.7 0.9 Demand (Normal Distribution) Mean Std Deviation 15000 4500 17 Simulation Trials 18 Direct Labor Parts Cost per Unit $85.36 91.68 93.35 $98.56 $88.36 First-Year Demand 17.366 12,900 20,686 0.888 14,259 20 21 Trial Cost per Un Profit 1,025,570 $461.828 $1.288,906 24 648,911 ($71.739) S1,110952 $703.118 45 516 517 18 519 520 521 496 497 498 499 $94.38 $90.85 90.37 92.50 19.257 14,920 13.471 18,614 43 1,056.847 523 524 525 526 527 Summary Statistics Mean Profit Standard Deviation Minimum Profit Maximum Profit Number of Losses Probability of Loss $698.457 ($785,234) $2.367.058
Fantastic news! We've Found the answer you've been seeking!
Step by Step Answer:
Answer rating: 61% (13 reviews)
Butler Inventory simulation spreadsheet The shortage cost has been ...View the full answer
Answered By
Asim farooq
I have done MS finance and expertise in the field of Accounting, finance, cost accounting, security analysis and portfolio management and management, MS office is at my fingertips, I want my client to take advantage of my practical knowledge. I have been mentoring my client on a freelancer website from last two years, Currently I am working in Telecom company as a financial analyst and before that working as an accountant with Pepsi for one year. I also join a nonprofit organization as a finance assistant to my job duties are making payment to client after tax calculation, I have started my professional career from teaching I was teaching to a master's level student for two years in the evening.
My Expert Service
Financial accounting, Financial management, Cost accounting, Human resource management, Business communication and report writing. Financial accounting : • Journal entries • Financial statements including balance sheet, Profit & Loss account, Cash flow statement • Adjustment entries • Ratio analysis • Accounting concepts • Single entry accounting • Double entry accounting • Bills of exchange • Bank reconciliation statements Cost accounting : • Budgeting • Job order costing • Process costing • Cost of goods sold Financial management : • Capital budgeting • Net Present Value (NPV) • Internal Rate of Return (IRR) • Payback period • Discounted cash flows • Financial analysis • Capital assets pricing model • Simple interest, Compound interest & annuities
4.40+
65+ Reviews
86+ Question Solved
Related Book For
Quantitative Methods for Business
ISBN: 978-0324651751
11th Edition
Authors: David Anderson, Dennis Sweeney, Thomas Williams, Jeffrey cam
Question Posted:
Students also viewed these Statistics questions
-
Develop your own worksheet for the PortaCom simulation model described in Section 161 a Compute the mean profit the minimum profit and the maximum profit b What is your estimate of the probability of...
-
The vehicle model shown in Figure 13.4.2(a) has the following parameter values: weight = 4800 lb, 1G = 1800 slug-ft2, L1 = 3.5 ft, and L2 = 2.5 ft. Design the front and rear suspension stiffnesses to...
-
Consider the first-order SDM model shown in figure(a) Show that the quantization noise power in the signal hand {-B, B} is given by:(b) Using a two-term Taylor series expansion of the sine function...
-
Find the point on the plane z = x + y + 1 closest to the point P = (1, 0, 0). Minimize the square of the distance.
-
Assume that you are employed in technical sales in powder-metallurgy products. What applications currently using non-P/M parts would you try to develop? What would you advise your potential customers...
-
Along with the Report of Condition submitted above, Norfolk has also prepared a Report of Income for the FDIC. Please fill in the missing items from its statement shown below (all figures in millions...
-
In a pretest, 30 respondents were asked to express their preference for an outdoor lifestyle (V1) using a 7 -point scale $(1=$ not at all preferred, 7 = greatly preferred $)$. They were also asked to...
-
A ccess the FASBs Codification Research System at the FASB website (www.fasb.org). Required: Determine the specific citation for accounting for each of the following items: 1. If it is only...
-
The Assembly Department of the Long-Distance Golf Club Super Driver Company, has the following production and cost data at the end of March, 2021. Production: 21,800 units started into production;...
-
Creating a Partnership Tax Return Overview You are a senior tax accountant in the firm, Ernest & Rainhouse. Joe, a new junior accountant, has just completed an interview with a new client Harry,...
-
A building contractor is preparing a bid on a new construction project. Two other contractors will be submitting bids for the same project. Based on past bidding practices, bids from the other...
-
In preparing for the upcoming holiday season, Mandrell Toy Company designed a new doll called Freddy. The fixed cost to produce the doll is $100,000. The variable cost, which includes material,...
-
Double entry Jack owns a business selling computers. The following transactions took place during the first week of September. Required State the ledger accounts to be debited and credited to record...
-
Saying that a quantitative trait exhibits a continuum means that a. the numerical value for the trait increases with the age of the individual. b. environmental effects are additive. c. the...
-
The government has today imposed a price ceiling on gasoline purchased at the pump. As one member of Congress said, It was done to keep gasoline prices within the reach of the poor and the...
-
An antibiotic is a drug that kills or inhibits the growth of microorganisms. The use of antibiotics has been of great importance in the battle against many infectious diseases caused by...
-
With regard to the CRISPR-Cas system that defends bacteria against bacteriophage attack, what happens during the adaptation, expression, and interference phases? When a bacterium is exposed to a...
-
A hypothetical base sequence of an RNA molecule is 5AUUUGCCCUAGCAAACGUAGCAAACG3 Using two of the three underlined parts of this sequence, draw two possible stem-loop structures that might form in...
-
Explain the two tests used to determine whether an employee is exempt from overtime requirements under the seasonal amusement and recreational establishment exemptions in the FLSA.
-
Read the case study Richter: Information Technology at Hungarys Largest Pharma and answer the following question: How does the organization ensure the accuracy of the data it stores?
-
Using the formulation and boundary condition results of the thin notch crack problem shown in Fig. 8.29, explicitly develop the stress components given by relations (8.4.56) and (8.4.57). Fig 8.29...
-
Manning Autos operates an automotive service. To complete their repair work, Manning mechanics often need to retrieve parts from the company's parts department counter. Mechanics arrive at the parts...
-
Develop your own waiting line simulation model for the Black Sheep Scarves problem described in Section 12.3. Assume that a quality inspection department for a new production facility is expected to...
-
The Burger Dome waiting line model in Section 11.1 studies the waiting time of customers at its fast-food restaurant. Burger Dome's single-server waiting line system has an arrival rate of 0.75...
-
China and India have the resources to produce textiles and toys India produces 10 units of textiles per hour of labor and 20 units of toys per hour China produces 10 units of textiles per hour and...
-
With so many policy variations to choose from, Ross and Jamie Lee are unsure which company is offering the most competitive rates.question How will they be able to compare the rates between the...
-
For each of the following, find the transition matrix corresponding to the change of basis from the standard basis E = {e1, e2} to {u, u2}: 1. (5pts) u = 12= (4) Answer: 2. (5pts) u = 12= Answer: 23
Study smarter with the SolutionInn App