Draw the complete structure of the deoxyribonuclcotide sequence from which the mRNA codon in Problem 28.24 was
Question:
Draw the complete structure of the deoxyribonuclcotide sequence from which the mRNA codon in Problem 28.24 was transcribed.
Problem 28.24
UAC is a codon for tyrosine it was transcribed from ATG of the template strand of a DNA chain.
Fantastic news! We've Found the answer you've been seeking!
Step by Step Answer:
Answer rating: 75% (16 reviews)
UAC is a codon for tyrosine it was transcribed ...View the full answer
Answered By
Larlyu mosoti
I am a professional writer willing to do several tasks free from plagiarism, grammatical errors and submit them in time. I love to do academic writing and client satisfaction is my priority. I am skilled in writing formats APA, MLA, Chicago, and Harvard I am a statistics scientist and I can help out in analyzing your data. I am okay with SPSS, EVIEWS, MS excel, and STATA data analyzing tools.
Statistical techniques: I can do linear regression, time series analysis, logistic regression, and some basic statistical calculations like probability distributions. . I'm ready for your working projects!
Services I would offer:
• Academic writing.
• Article writing.
• Data entry.
• PDF conversion.
• Word conversion
• Proofreading.
• Rewriting.
• Data analyzing.
The best reason to hire me:
- Professional and Unique work in writing.
- 100% satisfaction Guaranteed
- within required time Express delivery
- My work is plagiarism Free
- Great communication
My passion is to write vibrantly with dedication. I am loyal and confident to give my support to every client. Because Client satisfaction is much more important to me than the payment amount. A healthy client-contractor relationship benefits in the longer term. Simply inbox me if you want clean work.
5.00+
3+ Reviews
10+ Question Solved
Related Book For
Question Posted:
Students also viewed these Organic Chemistry questions
-
Draw the complete structure of the following peptide. Ser-Gln-Met NH2
-
Draw the complete structure of the ribonucleotide codon UAC, for what amino acid does this sequence code?
-
A mRNA strand has the sequence - 5CCAUCCGGCAUACCAAAUUACUAAACUAGC3-
-
Question 4: Partners M, N, and O agreed to share the net income or loss in the ratio of 5:4:3 respectively. Their capital balances were Rs.80, 000, Rs. 70, 000 and Rs. 60, 000. They decided that "O"...
-
What five entry modes do firms consider as paths to use to enter international markets? What is the typical sequence in which firms use these entry modes?
-
Now that some time has passed since the official launch of the iPad, has this product lived up to its early hype? Has it become the next "big thing" for Steve Jobs and Apple?
-
Amy Baat, a local real estate broker, has been appointed to the board of directors of the PennMed Corporation. At a recent board meeting, Baat discovered two planned expenditures for auditing: The...
-
Dry air is bubbled through 25.0 liters of water at a rate of 15.0 liters (STP)/min. The air leaving the liquid is saturated with water at 25C and 1.5 atm. How long will it take for all of the water...
-
Geographical presence: Production in the UK and sales across Europe; UK and Germany main markets (90%) Additional notes: The company has sold non-core assets during 2022, generating a profit of...
-
Ethan is the leader of a team with N members. He has assigned an error score to each member in his team based on the bugs that he has found in that particular team member's task. Because the error...
-
What anti codon sequences of tRNAs are coded for by the codons in Problem 28.21? Problem 28.21 For what amino acids do the following ribonucleotide triplets code? (a) AAU (b) GAG (c) UCC (d) CAU
-
Give an mRNA sequence that will code for synthesis of metenkephalin. Tyr-Gly-Gly- Phe-Met
-
Samsung (www.Samsung.com), Apple, and Google are competitors in the global market-place. Selected results from these companies follow. Required 1. Compute Samsung's debt-to-equity ratio for the...
-
A 55 kg gymnast lands stiff-legged on the floor and changes her horizontal velocity from -6 m/s to zero in 0.17 seconds. Compute the average resultant force working on the jumper. If she increased...
-
2. A string is wrapped several times around the rim of a small hoop with a radius of 0.0800 m and a mass of 0.190 kg. The free end of the string is held in place and the hoop is released from rest...
-
A piano wire with mass 3.35 g and length 78.0 cm is stretched with a tension of 32.0 N. Awave with frequency 115 Hz and amplitude 1.90 mm travels along the wire Part A Calculate the average power...
-
When a star between 9-25 solar masses reaches the end of its life, fusion in the core halts and the core can no longer withstand gravitational pressure. Gravity causes the ~2.5 solar mass core to...
-
1. Calculate the focal lengths for the following thin lenses made of glass of refractive index n = 1.50. The medium surrounding the lens on both sides is air. (a) Converging lens: left surface is...
-
It happens every year: A prominent organization bans a practice the public holds dear; an uproar ensues; the organization backs down in the face of bad publicity. So it happened at Torontos posh new...
-
Match each of the key terms with the definition that best fits it. _______________ A record of the sequence of data entries and the date of those entries. Here are the key terms from the chapter. The...
-
Eighteen kilograms of the refrigerant HFC-134a at 150C is contained in a 0.03-m 3 tank. Compare the prediction you can make for the pressure in the tank with that obtained using Fig. 3.3-4. For data,...
-
Draw the structures of the following RNA components: a. UCC b. CAA c. ACG
-
Using eq. 18.2 as a guide, write an equation for hydrolysis of a. 2-deoxythymidine b. 2-deoxyguanosine
-
Consider the following mRNA sequence: 5' A--G--C--U--C--G--U--A--C 3' Draw the segment of DNA double helix from which this sequence was derived, using the schematic method shown at the right of...
-
Diverse Perspectives on the World Economy assignment You are required to consider a contemporary economic or social issue that is currently attracting media attention. It could be a local, national,...
-
Daniel made the following transactions during the first week of January. 1 January Buys stock for 350 on credit 3 January Makes sales of 740 on credit 4 January Cash paid to a supplier of 120, for...
-
Please answer all parts of the following question. Given the following information: Total Product (TP) Price Fixed Cost (TFC) Variable Cost (TVC) 0 $1000 $600 $ 0 1 1000 600 1200 2 1000 600 2000 3...
Study smarter with the SolutionInn App