A mRNA strand has the sequence - 5CCAUCCGGCAUACCAAAUUACUAAACUAGC3-
Question:
- 5ʹCCAUCCGGCAUACCAAAUUACUAAACUAGC3ʹ-
Fantastic news! We've Found the answer you've been seeking!
Step by Step Answer:
Answer rating: 53% (13 reviews)
As the mRNA is read in the 5 to the 3 direction the AUG and ...View the full answer
Answered By
Joseph Mwaura
I have been teaching college students in various subjects for 9 years now. Besides, I have been tutoring online with several tutoring companies from 2010 to date. The 9 years of experience as a tutor has enabled me to develop multiple tutoring skills and see thousands of students excel in their education and in life after school which gives me much pleasure. I have assisted students in essay writing and in doing academic research and this has helped me be well versed with the various writing styles such as APA, MLA, Chicago/ Turabian, Harvard. I am always ready to handle work at any hour and in any way as students specify. In my tutoring journey, excellence has always been my guiding standard.
4.00+
1+ Reviews
10+ Question Solved
Related Book For
Organic Chemistry A Short Course
ISBN: 978-1111425562
13th edition
Authors: Harold Hart, Christopher M. Hadad, Leslie E. Craine, David J. Hart
Question Posted:
Students also viewed these Organic Chemistry questions
-
The sequence of the sense strand of a mammalian gene is...
-
A DNA strand has the following sequence: 5'-GATCCCGATCCGCATACATTTACCAGATCACCACC-3' In which direction would DNA polymerase slide along this strand (from left to right or from right to left)? If this...
-
Can a DNA strand bind to a complementary RNA strand? Explain.
-
If the molecular weight of air is 28.9, what is the density of air at atmospheric pressure and a temperature of 328.2 K? 1 atm = 1.013 x 10 5 N/m, the mass of a proton is 1.67262 x 10 -27 kg,...
-
Given MA inclined plane = length of plane / height of plane, find each missingquantity. MA Length of Plane Height of Plane 6. 9.00 7. 8. 1.30 9 10. 17.4 3.40 ft 3.79 m ft 74.0 cm in. ft 0.821 m 9.72...
-
The acceleration of a particle is defined by the relation a = kt2. (a) Knowing that v = 10 m/s when t = 0 and that v = 10 m/s when t = 2 s, determine the constant k. (b) Write the equations of...
-
How to prepare a witness for deposition?
-
One reason accounting earnings might not be a realistic measure of economic income is the incentive and ability of business managers to manipulate reported profits for their own benefit. This may be...
-
15. You own and manage a firm.Can the value of your firm grow over time if all you can do is sustain value?Briefly explain.
-
Kara is opening up a new daycare business in her home. She needs $6500 to purchase toys and a backyard playset. Kara makes a 10% down payment and finances the balance with a 48-month fixed...
-
From Table 18.2, are mutations in the first or second base of a codon more or less serious than mutations at the third base? Table 18.2The Genetic Code; Translation of the Codons into Amino Acids...
-
What peptide would be synthesized from the following DNA sequence? 5TTACCGACTGGTCACTCCCAT3
-
List ten different constraints in the temptation analysis pattern.
-
Create a weather-tracking application. Define a list to store daily temperature data for a week. Each element should be a dictionary representing a day with keys such as date, high temperature, low...
-
A fluid has density 1,260 kg m and is a Newtonian fluid. It is pumped at 471 litres per minute through a straight smooth-walled pipe of diameter 100 mm and length 20 m. Flow is laminar. The pressure...
-
Bloem Clinic treat patients with various illnesses. The clinic has 3 main operating departments and two service departments. The main operating departments consist of the General Practitioner's...
-
Situation - You have learned that an employee is writing a publicly-accessible blog. The employee is using their own name, and the name of the company. In the blog the employee makes accurate and...
-
Develop a software application for a savings and loans company. Define a set of variables that store the following information: customer's name, account balance, account type (e.g., savings,...
-
Arthur Andersen, a consulting company, was taken to court for destroying evidence that could have been used in court to support allegations of illegal activities. Arthur Andersen destroyed evidence...
-
How can NAFTA be beneficial to suppliers of Walmart?
-
Write the structures of the cyclic acetals derived from each of the following. (a) Cyclohexanone and ethylene glycol (b) Benzaldehyde and 1, 3-propanediol (c) Isobutyl methyl ketone and ethylene...
-
Asked you to write a mechanism describing formation of benzaldehyde diethyl acetal from benzaldehyde and ethanol, write a stepwise mechanism for the acid hydrolysis of this acetal.
-
Acetal formation is a characteristic reaction of aldehydes and ketones, but not of carboxylic acids. Show how you could advantageously use a cyclic acetal protecting group in the following synthesis:
-
Balance per bank statement Less: outstanding cheques ARKIN Company Bank reconciliation May 31, 2014 6124 6138 6139 6140 add: deposit in transit 2125 932,65 30928,46 960,57 1420 5438,22 25490,24...
-
Company "A" is a manufacturer of wooden and metal structures (20XX) Costs 1. Consumable supplies in the factory warehouse 2. Sandpaper 3. Lubricants 4. Indirect costs: wages 5. Wages of production...
-
Write down at leastfive items (durable goods, not food) that you purchase and their sourcing (where each is from). For example, a shirt may be assembled in China, designed in the US, and made from...
Study smarter with the SolutionInn App