For A, B, C s U, prove that A (B - C) = (A B)
Question:
A × (B - C) = (A × B) - (A × C).
Fantastic news! We've Found the answer you've been seeking!
Step by Step Answer:
Answer rating: 50% (8 reviews)
x y A B C x A and y B C ...View the full answer
Answered By
Mario Alvarez
I teach Statistics and Probability for students of my university ( Univerisity Centroamerican Jose Simeon Canas) in my free time and when students ask for me, I prepare and teach students that are in courses of Statistics and Probability. Also I teach students of the University Francisco Gavidia and Universidad of El Salvador that need help in some topics about Statistics, Probability, Math, Calculus. I love teaching Statistics and Probability! Why me?
** I have experience in Statistics and Probability topics for middle school, high school and university.
** I always want to share my knowledge with my students and have a great relationship with them.
** I have experience working with students online.
** I am very patient with my students and highly committed with them
5.00+
1+ Reviews
10+ Question Solved
Related Book For
Discrete and Combinatorial Mathematics An Applied Introduction
ISBN: 978-0201726343
5th edition
Authors: Ralph P. Grimaldi
Question Posted:
Students also viewed these Linear Algebra questions
-
(a) Prove that if u is orthogonal to both v and w, then u is orthogonal to v + w. (b) Prove that if u is orthogonal to both v and w, then u is orthogonal to sv + tw for all scalars s and t.
-
Prove that the image of a span equals the span of the images. That is, where h: V W is linear, prove that if S is a subset of V then h([S]) equals [h(S)]. This generalizes Lemma 2.1 since it shows...
-
A linear transformation S: U U is called skew-adjoint if S* = -S. (a) Prove that a skew-symmetric matrix is skew-adjoint with respect to the standard dot product on Rn. (b) Under what conditions is...
-
In terms of Federal tax consequences, why are lifetime transfers to charity preferable to testamentary transfers?
-
In the event of a disaster situation at State University from weather, an accident, or terrorism, victims will be transported by emergency vehicles to three area hospitals: County General, Memorial,...
-
Use the systematic process for conducting analytical procedures provided in Figure \(9-8\) to design an approach for developing an expectation for the commissions expense account for an electronics...
-
1. Why did Carnival Cruise Line think the OceanMedallion would help increase their cruise sales? 2. What is the services component of the OceanMedallion called and what technologies does it use? 3....
-
The following are auditor judgments and attributes sampling results for six populations. Assume large population sizes. .:. Required a. For each population, did the auditor select a smaller sample...
-
San Lorenzo General Store uses a periodic inventory system and the retail inventory method to estimate ending inventory and cost of goods sold. The following data are available for the month of...
-
I. THE CASE 0 n February 15, 2019, the Chief Operating Officer of Larson Industries, Pete Moreen, announced a major step forward for the company: Today, we have entered into an agreement to sell our...
-
If A = {1, 2, 3, 4}, B = {2, 5}, and C = {3, 4, 7}, determine A B; (B A); A U (B C); (A B) C; (A C) U (B C).
-
Let <31 c N X N where (m, n) e 31 if (and only if) n = 5m + 2. (a) Give a recursive definition for 31. (b) Use the recursive definition from part (a) to show that (4, 22) R.
-
Master Corporation plans a recapitalization. Explain the tax consequences of each of the following unrelated transactions: a. Holders of Class A nonvoting preferred stock exchange their stock for...
-
An antibiotic is a drug that kills or inhibits the growth of microorganisms. The use of antibiotics has been of great importance in the battle against many infectious diseases caused by...
-
With regard to the CRISPR-Cas system that defends bacteria against bacteriophage attack, what happens during the adaptation, expression, and interference phases? When a bacterium is exposed to a...
-
A hypothetical base sequence of an RNA molecule is 5AUUUGCCCUAGCAAACGUAGCAAACG3 Using two of the three underlined parts of this sequence, draw two possible stem-loop structures that might form in...
-
There are two sides to a marketa buying or demand side and a selling or supply side. Since most of us buy many more goods and services than we sell, lets consider the price a buyer pays for a good or...
-
The economist hears someone say: Business firms are all about maximizing revenue. If a firm is currently earning \($10\) million in total revenue, and it can sell 10 more units of whatever it is that...
-
Test the series for convergence or divergence. 00 n=1 4 - cos n n
-
Suppose that the electrical potential at the point (x, y, z) is E(x, y, z) = x + y - 2z. What is the direction of the acceleration at the point (1,3,2)?
-
Assume that variables in exponents represent natural numbers. (a) x2n + 5xn - 24 (b) 4x2n - 4xn - 3 (c) x2 + ax + bx + ab
-
Factor the trinomial. (a) w2 - 7w + 10 (b) p2 + 6p + 8 (c) x2 + 6x + 5
-
Factor the difference of squares. (a) z2 - 81 (b) m2 - 4 (c) 16x2 - 9
-
Assume that management wants wage concession from its counterpart labor union. Explain why this often leads to disputes. Suppose management gives up some of its future negotiating power by subjecting...
-
Why have you chosen this nursing Field of Specialization or Major? What influenced you in selecting your intended major of study and what goal(s) have you set for the future?
-
What are logical fallacies and how can they affect our decision-making?
Study smarter with the SolutionInn App