From Table 18.2, are mutations in the first or second base of a codon more or less
Question:
Transcribed Image Text:
Table 18.2The Genetic Code; Translation of the Codons into Amino Acids Third base (3' end) First base (5' end) Middle base Phe Ser Tyr Cys Phe Ser Tyr Leu Ser Stop Stop Leu Leu Ser Stop Trp Leu Leu Pro His Arg Leu Gln Gin His Arg Ile Thr Asn Ser lle Thr Asn Ser Val Met (start) Thr Lys Lys Val Val Ala Asp Gl Val Ala Glu Gly Asp Gly Glu Gly
Fantastic news! We've Found the answer you've been seeking!
Step by Step Answer:
Answer rating: 68% (19 reviews)
Mutations in the first and secon...View the full answer
Answered By
Kainat Shabbir
i am an experienced qualified expert with a long record of success helping clients overcome specific difficulties in information technology, business and arts greatly increasing their confidence in these topics. i am providing professional services in following concerns research papers, term papers, dissertation writing, book reports, biography writing, proofreading, editing, article critique, book review, coursework, c++, java, bootstarp, database.
5.00+
184+ Reviews
255+ Question Solved
Related Book For
Organic Chemistry A Short Course
ISBN: 978-1111425562
13th edition
Authors: Harold Hart, Christopher M. Hadad, Leslie E. Craine, David J. Hart
Question Posted:
Students also viewed these Organic Chemistry questions
-
To analyze the sequences in Table 3.2 (see the next page), you will use manual methods that were used by geneticists until the development of computer-based methods. However, to make your comparison...
-
Write a test bench for the elevator controller of Problem 5.10. The test bench has two functions: to simulate the operation of the elevator (including the door operation) and to provide a sequence of...
-
The block diagram for an elevator controller for a building with two floors is shown in the following diagram. The inputs FB 1 and FB 2 are floor buttons in the elevator. The inputs CALL 1 and CALL 2...
-
9. Write a program to solve function given below, with the x and y value proposed by the user. And, based on the result, show "imaginary result" response for the case of the result of the function is...
-
An inclined plane is 10.0 m long and 2.50 m high. (a) Find its mechanical advantage. (b) A resistance of 727 N is pushed up the plane. What effort is needed? (c) An effort of 200 N is applied to push...
-
A city levies property taxes of $500,000 for its General Fund for a year and expects to collect all except the estimated uncollectible amount of $5,500 by year-end. To reflect this information, the...
-
The following material has high internal damping: a. cast iron b. copper c. brass
-
Financial information is presented below for three different companies. InstructionsDetermine the missingamounts. Natural Mattar Allied Cosmetics Grocery Wholesalers Sales $90,000 (e) $144.000 (a)...
-
The marketing department of Jessi Corporation has submitted the following sales forecast for the upcoming fiscal year (all sales are on account): 1st Quarter Budgeted unit sales, 12,000 2nd Quarter...
-
Table 1 shows Apple's online orders for the last week. When shoppers place an online order, several "recommended products" (upsells) are shown as at checkout an attempt to upsell See table 2 in cell...
-
Consider Table 18.2. Will any changes occur in the resultant biosynthesized protein by a purine purine mutation in the third base of a codon? In a pyrimidine pyrimidine mutation in the third base of...
-
A mRNA strand has the sequence - 5CCAUCCGGCAUACCAAAUUACUAAACUAGC3-
-
The Log Cabin Cafe acquired Hungry Boy Diners. The financial records of Hungry Boy Diners included: Book Value of Assets ..................................... $440,000 Market Value of Assets...
-
A cursor in the Oracle database can be mapped to a(n) data type. a. jdbc.oracle.CURSOR b. oracle.jdbc.OracleTypes.CURSOR c. oracle.jdbc.CURSOR d. jdbc.CURSOR
-
Compare the marginal utility per dollar from train travel and from air travel. As the time it takes to get through airports has increased, other means of travel have begun to look more attractive....
-
When building an Oracle stored procedure to update a record in a database, each input parameter . a. Can have a different name from the associated column name in the database b. Can have the same...
-
There are two parts in an Oracle Package: and a. Specification, body b. Definition, specifications c. Body, specification d. Specification, execution
-
The java.awt package contains all basic and fundamental graphic user interface components. However, the javax.swing package contains extensions of java.awt, which means that all components in the...
-
Assessing the emerging role and responsibilities of the organizations chief information officer and other organizational functions that are responsible to ensure information security and privacy.
-
Three forces with magnitudes of 70pounds, 40 pounds, and 60 pounds act on an object at angles of 30, 45, and 135, respectively, with the positive x-axis. Find the direction and magnitude of the...
-
Chloral is one of the common names for trichloroethanal. A solution of chloral in water is called chloral hydrate; this material has featured prominently in countless detective stories as the...
-
The hydroxyl group of a cyanohydrin is also a potentially reactive site. Methacrylonitrile is an industrial chemical used in the production of plastics and fibers. One method for its preparation is...
-
Write a stepwise mechanism for the formation of benzaldehyde diethyl acetal from benzaldehyde and ethanol under conditions of acid catalysis.
-
I am working in aMobile company that is seeking to introduce a novel mobile application that implements a monthly subscription fee for its users. After conducting a comprehensive analysis, the...
-
Tatiana has recently entered a profile into the Express Entry (EE) system as a candidate under the Canadian Experience Class (CEC). She has also met the requirements to qualify under the FSW. Tatiana...
-
Columbia Corp. is a young, rapidly growing company that manufactures computer accessories and specialized components for networked computer workstations. It has some unique products and a strong...
Study smarter with the SolutionInn App