In Problems use the tangent line approximation. Given f(2) = 4, f'(2) = 3, approximate f(1.95).
Question:
In Problems use the tangent line approximation.
Given f(2) = −4, f'(2) = −3, approximate f(1.95).
Fantastic news! We've Found the answer you've been seeking!
Step by Step Answer:
Answer rating: 62% (16 reviews)
We have x 195 2 005 Fr...View the full answer
Answered By
Somshukla Chakraborty
I have a teaching experience of more than 4 years by now in diverse subjects like History,Geography,Political Science,Sociology,Business Enterprise,Economics,Environmental Management etc.I teach students from classes 9-12 and undergraduate students.I boards I handle are IB,IGCSE, state boards,ICSE, CBSE.I am passionate about teaching.Full satisfaction of the students is my main goal.
I have completed my graduation and master's in history from Jadavpur University Kolkata,India in 2012 and I have completed my B.Ed from the same University in 2013. I have taught in a reputed school of Kolkata (subjects-History,Geography,Civics,Political Science) from 2014-2016.I worked as a guest lecturer of history in a college of Kolkata for 2 years teaching students of 1st ,2nd and 3rd year. I taught Ancient and Modern Indian history there.I have taught in another school in Mohali,Punjab teaching students from classes 9-12.Presently I am working as an online tutor with concept tutors,Bangalore,India(Carve Niche Pvt.Ltd.) for the last 1year and also have been appointed as an online history tutor by Course Hero(California,U.S) and Vidyalai.com(Chennai,India).
4.00+
2+ Reviews
10+ Question Solved
Related Book For
Applied Calculus
ISBN: 9781119275565
6th Edition
Authors: Deborah Hughes Hallett, Patti Frazer Lock, Andrew M. Gleason, Daniel E. Flath, Sheldon P. Gordon, David O. Lomen, David Lovelock, William G. McCallum, Brad G. Osgood, Andrew Pasquale
Question Posted:
Students also viewed these Mathematics questions
-
Use the tangent line approximation to evaluate the following in two ways. First, find the tangent line to the whole function using the chain rule. Second, break the calculation into two pieces by...
-
In Exercises verify the tangent line approximation of the function at the given point. Then use a graphing utility to graph the function and its approximation in the same viewing window. Function...
-
Use the tangent line and secant line to estimate the following values. Make sure to identify the base point a you used for your tangent line approximation and the second point you used for the secant...
-
4. (a) (c) 6 -6 5 6 5 7 6 (b) (d) -5 6 6 -7 [6-5] 7-6
-
At the beginning of an accounting period, a company's revenue, expense, and dividend accounts will always have zero balances. Do you agree or disagree? Explain.
-
Describe how you might use simulation with different assumptions about the amount of initial financing to help determine the investment that would help assure that good outcomes are not missed but...
-
In Joule-Thomson effect, there will be a cooling effect when (a) \(\mu=-\mathrm{ve}\) (b) \(\mu=+\mathrm{ve}\) (c) \(\mu=\alpha\) (d) Indeterminate.
-
1. How does Pojman link ethnocentrism to relativism? 2. How does Pojman explain the way that the diversity thesis and the dependency thesis lead to relativism? 3. According to Pojman, what sorts of...
-
A Quincy man was arrested yesterday in connection with his alleged involvement in filing false tax returns on behalf of his company that hid over $10 million in corporate income. Su Nguyen, 60, was...
-
Use the definition of the derivative to show how the formulas in Problem are obtained. If f(x) = 5x, then f(x) = 5.
-
For Problem estimate the change in y for the given change in x. y = p(x), p'(400) = 2, x decreases from 400 to 398
-
(a) Determine the condition which the impulse response b (t) must satisfy to achieve this requirement. (b) What is the corresponding condition on the frequency response H (f) of the filter?
-
An antibiotic is a drug that kills or inhibits the growth of microorganisms. The use of antibiotics has been of great importance in the battle against many infectious diseases caused by...
-
With regard to the CRISPR-Cas system that defends bacteria against bacteriophage attack, what happens during the adaptation, expression, and interference phases? When a bacterium is exposed to a...
-
A hypothetical base sequence of an RNA molecule is 5AUUUGCCCUAGCAAACGUAGCAAACG3 Using two of the three underlined parts of this sequence, draw two possible stem-loop structures that might form in...
-
There are two sides to a marketa buying or demand side and a selling or supply side. Since most of us buy many more goods and services than we sell, lets consider the price a buyer pays for a good or...
-
The economist hears someone say: Business firms are all about maximizing revenue. If a firm is currently earning \($10\) million in total revenue, and it can sell 10 more units of whatever it is that...
-
The Game Over computerized football game has far exceeded demand expectations. In order to increase the availability of different models of the game, the manufacturer has decided to begin producing...
-
The age-old saying for investing is "buy low and sell high," but this is easier said than done. Investors who panic about falling prices sell their investments, which in turn lowers the price and...
-
Determine whether each of the following functions is continuous and/or differentiable at x = 1. f(x) = x-1 for 0 < x < 1 1 for x = 1 2x 2 for x>1
-
Explain the relationship between derivatives and velocity and acceleration.
-
Determine which of the following limits exist. Compute the limits that exist. x - X 9 x x - x x uu![
-
During 2022, Christiana's employer withheld $1,500 from her wages for state income taxes. She claimed the $1,500 as an itemized deduction on her 2022 federal income tax return which included $14,000...
-
Calculate the contribution margin of a product for a service company if revenues are $ 5 0 , 0 0 0 , variable expenses are $ 3 0 , 0 0 0 , and fixed expenses are $ 1 5 , 0 0 0 .
-
DAU Natoma Industries Case - Tuller has so many issues and stakeholders what course of actions are there? Explain.
Study smarter with the SolutionInn App